diff --git a/CMakeLists.txt b/CMakeLists.txt
index d4aa351..bc40e61 100644
--- a/CMakeLists.txt
+++ b/CMakeLists.txt
@@ -14,6 +14,7 @@ find_package(SDL2 REQUIRED COMPONENTS SDL2::SDL2-static SDL2::SDL2main CONFIG)
 find_package(OpenAL REQUIRED CONFIG)
 find_library(physfs REQUIRED NAMES physfs-static PATHS "${CMAKE_PREFIX_PATH}/lib")
 
+
 # Determine dependencies
 set(STATIC_LIBS
 	dr_wav
diff --git a/src/game/astronomy/apparent-size.cpp b/src/game/astronomy/apparent-size.cpp
index f8d2db7..9d60fc5 100644
--- a/src/game/astronomy/apparent-size.cpp
+++ b/src/game/astronomy/apparent-size.cpp
@@ -23,7 +23,7 @@
 namespace ast
 {
 
-double angular_radius(double radius, double distance)
+double find_angular_radius(double radius, double distance)
 {
 	return std::asin(radius / distance);
 }
diff --git a/src/game/astronomy/apparent-size.hpp b/src/game/astronomy/apparent-size.hpp
index d3ec3d0..dfce155 100644
--- a/src/game/astronomy/apparent-size.hpp
+++ b/src/game/astronomy/apparent-size.hpp
@@ -24,13 +24,13 @@ namespace ast
 {
 
 /**
- * Calculates the angular radius of a celestial object.
+ * Finds the angular radius of a celestial object, given its radius and distance.
  *
  * @param radius Radius of the celestial object.
  * @param distance Distance to the celestial object.
  * @return Angular radius, in radians.
  */
-double angular_radius(double radius, double distance);
+double find_angular_radius(double radius, double distance);
 
 } // namespace ast
 
diff --git a/src/game/astronomy/celestial-coordinates.cpp b/src/game/astronomy/celestial-coordinates.cpp
index 7a9aa43..194b798 100644
--- a/src/game/astronomy/celestial-coordinates.cpp
+++ b/src/game/astronomy/celestial-coordinates.cpp
@@ -58,14 +58,14 @@ double3x3 ecliptic_to_equatorial(double ecl)
 	};
 }
 
-double3x3 ecliptic_to_horizontal(double ecl, double lat, double lmst)
+double3x3 ecliptic_to_horizontal(double ecl, double lat, double lst)
 {
 	const double c_ecl = std::cos(ecl);
 	const double s_ecl = std::sin(ecl);
 	const double c_lat = std::cos(lat);
 	const double s_lat = std::sin(lat);
-	const double c_lst = std::cos(lmst);
-	const double s_lst = std::sin(lmst);
+	const double c_lst = std::cos(lst);
+	const double s_lst = std::sin(lst);
 	
 	return double3x3
 	{
@@ -88,12 +88,12 @@ double3x3 equatorial_to_ecliptic(double ecl)
 	};
 }
 
-double3x3 equatorial_to_horizontal(double lat, double lmst)
+double3x3 equatorial_to_horizontal(double lat, double lst)
 {
 	const double c_lat = std::cos(lat);
 	const double s_lat = std::sin(lat);
-	const double c_lst = std::cos(lmst);
-	const double s_lst = std::sin(lmst);
+	const double c_lst = std::cos(lst);
+	const double s_lst = std::sin(lst);
 	
 	return double3x3
 	{
@@ -103,12 +103,12 @@ double3x3 equatorial_to_horizontal(double lat, double lmst)
 	};
 }
 
-double3x3 horizontal_to_equatorial(double lat, double lmst)
+double3x3 horizontal_to_equatorial(double lat, double lst)
 {
 	const double c_lat = std::cos(lat);
 	const double s_lat = std::sin(lat);
-	const double c_lst = std::cos(lmst);
-	const double s_lst = std::sin(lmst);
+	const double c_lst = std::cos(lst);
+	const double s_lst = std::sin(lst);
 	
 	return double3x3
 	{
@@ -118,14 +118,14 @@ double3x3 horizontal_to_equatorial(double lat, double lmst)
 	};
 }
 
-double3x3 horizontal_to_ecliptic(double ecl, double lat, double lmst)
+double3x3 horizontal_to_ecliptic(double ecl, double lat, double lst)
 {
 	const double c_ecl = std::cos(ecl);
 	const double s_ecl = std::sin(ecl);
 	const double c_lat = std::cos(lat);
 	const double s_lat = std::sin(lat);
-	const double c_lst = std::cos(lmst);
-	const double s_lst = std::sin(lmst);
+	const double c_lst = std::cos(lst);
+	const double s_lst = std::sin(lst);
 	
 	return double3x3
 	{
diff --git a/src/game/astronomy/celestial-coordinates.hpp b/src/game/astronomy/celestial-coordinates.hpp
index 7b401a3..b2e4cb5 100644
--- a/src/game/astronomy/celestial-coordinates.hpp
+++ b/src/game/astronomy/celestial-coordinates.hpp
@@ -54,10 +54,10 @@ double3x3 ecliptic_to_equatorial(double ecl);
  *
  * @param ecl Obliquity of the ecliptic, in radians.
  * @param lat Observer's latitude, in radians.
- * @param lmst Local mean sidereal time.
+ * @param lst Local sidereal time, in radians.
  * @return Transformation matrix.
  */
-double3x3 ecliptic_to_horizontal(double ecl, double lat, double lmst);
+double3x3 ecliptic_to_horizontal(double ecl, double lat, double lst);
 
 /**
  * Produces a matrix which transforms rectangular coordinates from equatorial space to ecliptic space.
@@ -71,29 +71,29 @@ double3x3 equatorial_to_ecliptic(double ecl);
  * Produces a matrix which transforms rectangular coordinates from equatorial space to horizontal space.
  *
  * @param lat Observer's latitude, in radians.
- * @param lmst Local mean sidereal time.
+ * @param lst Local sidereal time, in radians.
  * @return Transformation matrix.
  */
-double3x3 equatorial_to_horizontal(double lat, double lmst);
+double3x3 equatorial_to_horizontal(double lat, double lst);
 
 /**
  * Produces a matrix which transforms rectangular coordinates from horizontal space to equatorial space.
  *
  * @param lat Observer's latitude, in radians.
- * @param lmst Local mean sidereal time.
+ * @param lst Local sidereal time, in radians.
  * @return Transformation matrix.
  */
-double3x3 horizontal_to_equatorial(double lat, double lmst);
+double3x3 horizontal_to_equatorial(double lat, double lst);
 
 /**
  * Produces a matrix which transforms rectangular coordinates from horizontal space to ecliptic space.
  *
  * @param ecl Obliquity of the ecliptic, in radians.
  * @param lat Observer's latitude, in radians.
- * @param lmst Local mean sidereal time.
+ * @param lst Local sidereal time, in radians.
  * @return Transformation matrix.
  */
-double3x3 horizontal_to_ecliptic(double ecl, double lat, double lmst);
+double3x3 horizontal_to_ecliptic(double ecl, double lat, double lst);
 
 /// Matrix which transforms coordinates from horizontal space to a right-handed coordinate system.
 constexpr double3x3 horizontal_to_right_handed =
diff --git a/src/game/astronomy/celestial-mechanics.cpp b/src/game/astronomy/celestial-mechanics.cpp
index 9e4565a..3ac4574 100644
--- a/src/game/astronomy/celestial-mechanics.cpp
+++ b/src/game/astronomy/celestial-mechanics.cpp
@@ -24,111 +24,6 @@
 namespace ast
 {
 
-double approx_ecliptic_obliquity(double jd)
-{
-	return math::radians<double>(23.4393 - 3.563e-7 * (jd - 2451545.0));
-}
-
-double3 approx_sun_ecliptic(double jd)
-{
-	const double t = (jd - 2451545.0) / 36525.0;
-	const double m = 6.24 + 628.302 * t;
-	
-	const double longitude = 4.895048 + 628.331951 * t + (0.033417 - 0.000084 * t) * std::sin(m) + 0.000351 * std::sin(m * 2.0);
-	const double latitude = 0.0;
-	const double distance = 1.000140 - (0.016708 - 0.000042 * t) * std::cos(m) - 0.000141 * std::cos(m * 2.0);
-	
-	double3 ecliptic;
-	ecliptic.x = distance * std::cos(longitude) * std::cos(latitude);
-	ecliptic.y = distance * std::sin(longitude) * std::cos(latitude);
-	ecliptic.z = distance * std::sin(latitude);
-	
-	return ecliptic;
-}
-
-double3 approx_moon_ecliptic(double jd)
-{
-	const double t = (jd - 2451545.0) / 36525.0;
-	const double l1 = 3.8104 + 8399.7091 * t;
-	const double m1 = 2.3554 + 8328.6911 * t;
-	const double m = 6.2300 + 628.3019 * t;
-	const double d = 5.1985 + 7771.3772 * t;
-	const double d2 = d * 2.0;
-	const double f = 1.6280 + 8433.4663 * t;
-	
-	const double longitude = l1
-		+ 0.1098 * std::sin(m1)
-		+ 0.0222 * std::sin(d2 - m1)
-		+ 0.0115 * std::sin(d2)
-		+ 0.0037 * std::sin(m1 * 2.0)
-		- 0.0032 * std::sin(m)
-		- 0.0020 * std::sin(d2)
-		+ 0.0010 * std::sin(d2 - m1 * 2.0)
-		+ 0.0010 * std::sin(d2 - m - m1)
-		+ 0.0009 * std::sin(d2 + m1)
-		+ 0.0008 * std::sin(d2 - m)
-		+ 0.0007 * std::sin(m1 - m)
-		- 0.0006 * std::sin(d)
-		- 0.0005 * std::sin(m + m1);
-	
-	const double latitude = 0.0895 * sin(f)
-		+ 0.0049 * std::sin(m1 + f)
-		+ 0.0048 * std::sin(m1 - f)
-		+ 0.0030 * std::sin(d2 - f)
-		+ 0.0010 * std::sin(d2 + f - m1)
-		+ 0.0008 * std::sin(d2 - f - m1)
-		+ 0.0006 * std::sin(d2 + f);
-	
-	const double r = 1.0 / (0.016593
-		+ 0.000904 * std::cos(m1)
-		+ 0.000166 * std::cos(d2 - m1)
-		+ 0.000137 * std::cos(d2)
-		+ 0.000049 * std::cos(m1 * 2.0)
-		+ 0.000015 * std::cos(d2 + m1)
-		+ 0.000009 * std::cos(d2 - m));
-	
-	double3 ecliptic;
-	ecliptic.x = r * std::cos(longitude) * std::cos(latitude);
-	ecliptic.y = r * std::sin(longitude) * std::cos(latitude);
-	ecliptic.z = r * std::sin(latitude);
-	
-	return ecliptic;
-}
-
-double3x3 approx_moon_ecliptic_rotation(double jd)
-{
-	const double t = (jd - 2451545.0) / 36525.0;
-	const double l1 = 3.8104 + 8399.7091 * t;
-	const double f = 1.6280 + 8433.4663 * t;
-	
-	const double az0 = f + math::pi<double>;
-	const double ax  = 0.026920;
-	const double az1 = l1 - f;
-	
-	double3x3 rz0 =
-	{
-		cos(az0), -sin(az0), 0,
-		sin(az0), cos(az0), 0,
-		0, 0, 1
-	};
-	
-	double3x3 rx =
-	{
-		1, 0, 0,
-		0, cos(ax), -sin(ax),
-		0, sin(ax), cos(ax)
-	};
-	
-	double3x3 rz1 =
-	{
-		cos(az1), -sin(az1), 0,
-		sin(az1), cos(az1), 0,
-		0, 0, 1
-	};
-	
-	return rz0 * rx * rz1;
-}
-
 double solve_kepler(double ec, double ma, double tolerance, std::size_t iterations)
 {
 	// Approximate eccentric anomaly, E
diff --git a/src/game/astronomy/celestial-mechanics.hpp b/src/game/astronomy/celestial-mechanics.hpp
index efa0ed8..0422f4b 100644
--- a/src/game/astronomy/celestial-mechanics.hpp
+++ b/src/game/astronomy/celestial-mechanics.hpp
@@ -47,38 +47,6 @@ struct orbital_state
 	double3 v; ///< Cartesian velocity, v.
 };
 
-/**
- * Approximates the obliquity of the ecliptic.
- *
- * @param jd Julian date.
- * @return Obliquity of the ecliptic, in radians.
- */
-double approx_ecliptic_obliquity(double jd);
-
-/**
- * Approximates the ecliptic coordinates of the Earth's sun.
- *
- * @param jd Julian date.
- * @return Ecliptic rectangular geocentric coordinates of the Earth's sun, with distance in AU.
- */
-double3 approx_sun_ecliptic(double jd);
-
-/**
- * Approximates the ecliptic coordinates of the Earth's moon.
- *
- * @param jd Julian date.
- * @return Ecliptic rectangular geocentric coordinates of the Earth's moon, with distance in Earth radii.
- */
-double3 approx_moon_ecliptic(double jd);
-
-/**
- * Approximates the ecliptic rotation of the Earth's moon.
- *
- * @param jd Julian date.
- * @return Rotation matrix representing the moon's rotation in ecliptic space.
- */
-double3x3 approx_moon_ecliptic_rotation(double jd);
-
 /**
  * Iteratively solves Kepler's equation for eccentric anomaly, E.
  *
diff --git a/src/game/astronomy/celestial-time.cpp b/src/game/astronomy/celestial-time.cpp
deleted file mode 100644
index c67a23f..0000000
--- a/src/game/astronomy/celestial-time.cpp
+++ /dev/null
@@ -1,62 +0,0 @@
-/*
- * Copyright (C) 2020  Christopher J. Howard
- *
- * This file is part of Antkeeper source code.
- *
- * Antkeeper source code is free software: you can redistribute it and/or modify
- * it under the terms of the GNU General Public License as published by
- * the Free Software Foundation, either version 3 of the License, or
- * (at your option) any later version.
- *
- * Antkeeper source code is distributed in the hope that it will be useful,
- * but WITHOUT ANY WARRANTY; without even the implied warranty of
- * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
- * GNU General Public License for more details.
- *
- * You should have received a copy of the GNU General Public License
- * along with Antkeeper source code.  If not, see <http://www.gnu.org/licenses/>.
- */
-
-#include "celestial-time.hpp"
-#include "math/angles.hpp"
-#include <cmath>
-
-namespace ast
-{
-
-double ut_to_jd(int year, int month, int day, int hour, int minute, double second)
-{
-	if (month < 3)
-	{
-		month += 12;
-		year -= 1;
-	}
-	
-	const signed long Y = year;
-	const signed long M = month;
-	const signed long D = day;	
-	const signed long JDN = (1461*(Y+4800+(M-14)/12))/4+(367*(M-2-12*((M-14)/12)))/12-(3*((Y+4900+(M-14)/12)/100))/4+D-32075;
-	
-	const double h = static_cast<double>(hour - 12) / 24.0;
-	const double m = static_cast<double>(minute) / 1440.0;
-	const double s = second / 86400.0;
-	
-	return static_cast<double>(JDN) + h + m + s;
-}
-
-double jd_to_gmst(double jd)
-{
-	return math::wrap_radians<double>(4.894961212 + 6.300388098 * (jd - 2451545.0));
-}
-
-double jd_to_lmst(double jd, double longitude)
-{
-	return gmst_to_lmst(jd_to_gmst(jd), longitude);
-}
-
-double gmst_to_lmst(double gmst, double longitude)
-{
-	return gmst + longitude;
-}
-
-} // namespace ast
diff --git a/src/game/astronomy/celestial-time.hpp b/src/game/astronomy/celestial-time.hpp
deleted file mode 100644
index 6f3a179..0000000
--- a/src/game/astronomy/celestial-time.hpp
+++ /dev/null
@@ -1,66 +0,0 @@
-/*
- * Copyright (C) 2020  Christopher J. Howard
- *
- * This file is part of Antkeeper source code.
- *
- * Antkeeper source code is free software: you can redistribute it and/or modify
- * it under the terms of the GNU General Public License as published by
- * the Free Software Foundation, either version 3 of the License, or
- * (at your option) any later version.
- *
- * Antkeeper source code is distributed in the hope that it will be useful,
- * but WITHOUT ANY WARRANTY; without even the implied warranty of
- * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
- * GNU General Public License for more details.
- *
- * You should have received a copy of the GNU General Public License
- * along with Antkeeper source code.  If not, see <http://www.gnu.org/licenses/>.
- */
-
-#ifndef ANTKEEPER_CELESTIAL_TIME_HPP
-#define ANTKEEPER_CELESTIAL_TIME_HPP
-
-namespace ast
-{
-
-/**
- * Calculates the Julian date from a universal time.
- *
- * @param year Gregorian year, with 1 BC as 0.
- * @param month Gregorian month, on [1, 12].
- * @param day Gregorian day, on [1, 31].
- * @param hour Hour, on [0, 23].
- * @param minute Minute, on [0, 59].
- * @param second Second on [0, 60).
- * @return Julian date with fractional day.
- */
-double ut_to_jd(int year, int month, int day, int hour, int minute, double second);
-
-/**
- * Calculates the Greenwich mean sidereal time (GMST) from a Julian date.
- *
- * @param jd Julian date.
- * @return GMST, in radians.
- */
-double jd_to_gmst(double jd);
-
-/**
- * Calculates local mean sidereal time (LMST) from a Julian date.
- *
- * @param jd Julian date.
- * @param longitude Longitude of the observer, in radians.
- */
-double jd_to_lmst(double jd, double longitude);
-
-/**
- * Calculates local mean sidereal time (LMST) from Greenwich mean sidereal time (GMST).
- *
- * @param gmst Greenwich mean sidereal time, in radians.
- * @param longitude Longitude of the observer, in radians.
- * @return Local mean sidereal time, in radians.
- */
-double gmst_to_lmst(double gmst, double longitude);
-
-} // namespace ast
-
-#endif // ANTKEEPER_CELESTIAL_TIME_HPP
diff --git a/src/game/bootloader.cpp b/src/game/bootloader.cpp
index 725b5e6..00c9f63 100644
--- a/src/game/bootloader.cpp
+++ b/src/game/bootloader.cpp
@@ -80,6 +80,7 @@
 #include "game/systems/painting-system.hpp"
 #include "game/systems/weather-system.hpp"
 #include "game/systems/astronomy-system.hpp"
+#include "game/systems/solar-system.hpp"
 #include "game/components/marker-component.hpp"
 #include "game/entity-commands.hpp"
 #include "utility/paths.hpp"
@@ -880,15 +881,16 @@ void setup_systems(game_context* ctx)
 	
 	// Setup weather system
 	ctx->weather_system = new weather_system(*ctx->ecs_registry);
-	ctx->weather_system->set_ambient_light(ctx->sun_indirect);
-	ctx->weather_system->set_sun_light(ctx->sun_direct);
-	ctx->weather_system->set_moon_light(ctx->moon_light);
 	ctx->weather_system->set_sky_pass(ctx->overworld_sky_pass);
 	ctx->weather_system->set_shadow_map_pass(ctx->overworld_shadow_map_pass);
 	ctx->weather_system->set_material_pass(ctx->overworld_material_pass);
 	
 	// Setup solar system
+	ctx->solar_system = new solar_system(*ctx->ecs_registry);
+	
+	// Setup astronomy system
 	ctx->astronomy_system = new astronomy_system(*ctx->ecs_registry);
+	ctx->astronomy_system->set_sky_pass(ctx->overworld_sky_pass);
 	
 	// Set time scale
 	float time_scale = 60.0f;
@@ -897,6 +899,7 @@ void setup_systems(game_context* ctx)
 		time_scale = ctx->config->get<float>("time_scale");
 	}
 	ctx->weather_system->set_time_scale(time_scale);
+	ctx->solar_system->set_time_scale(time_scale);
 	ctx->astronomy_system->set_time_scale(time_scale);
 	
 	// Setup render system
@@ -1196,6 +1199,7 @@ void setup_controls(game_context* ctx)
 		[ctx, time_scale]()
 		{
 			ctx->weather_system->set_time_scale(time_scale * 50.0f);
+			ctx->solar_system->set_time_scale(time_scale * 50.0f);
 			ctx->astronomy_system->set_time_scale(time_scale * 50.0f);
 		}
 	);
@@ -1204,6 +1208,7 @@ void setup_controls(game_context* ctx)
 		[ctx, time_scale]()
 		{
 			ctx->weather_system->set_time_scale(time_scale);
+			ctx->solar_system->set_time_scale(time_scale);
 			ctx->astronomy_system->set_time_scale(time_scale);
 		}
 	);
@@ -1212,6 +1217,7 @@ void setup_controls(game_context* ctx)
 		[ctx, time_scale]()
 		{
 			ctx->weather_system->set_time_scale(time_scale * -50.0f);
+			ctx->solar_system->set_time_scale(time_scale * -50.0f);
 			ctx->astronomy_system->set_time_scale(time_scale * -50.0f);
 		}
 	);
@@ -1220,6 +1226,7 @@ void setup_controls(game_context* ctx)
 		[ctx, time_scale]()
 		{
 			ctx->weather_system->set_time_scale(time_scale);
+			ctx->solar_system->set_time_scale(time_scale);
 			ctx->astronomy_system->set_time_scale(time_scale);
 		}
 	);
@@ -1281,6 +1288,7 @@ void setup_callbacks(game_context* ctx)
 			ctx->tracking_system->update(t, dt);
 			ctx->painting_system->update(t, dt);
 			ctx->weather_system->update(t, dt);
+			ctx->solar_system->update(t, dt);
 			ctx->astronomy_system->update(t, dt);
 			
 			//(*ctx->focal_point_tween)[1] = ctx->orbit_cam->get_focal_point();
diff --git a/src/game/cartography/relief-map.cpp b/src/game/cartography/relief-map.cpp
index 79dca15..9e830ad 100644
--- a/src/game/cartography/relief-map.cpp
+++ b/src/game/cartography/relief-map.cpp
@@ -74,6 +74,7 @@ mesh* map_elevation(const std::function<float(float, float)>& function, float sc
 		return edge;
 	};
 
+	// Connect vertices with edges and faces
 	const std::vector<mesh::vertex*>& vertices = mesh->get_vertices();
 	for (std::size_t i = 0; i < rows; ++i)
 	{
diff --git a/src/game/components/celestial-body-component.hpp b/src/game/components/celestial-body-component.hpp
new file mode 100644
index 0000000..0fc112c
--- /dev/null
+++ b/src/game/components/celestial-body-component.hpp
@@ -0,0 +1,55 @@
+/*
+ * Copyright (C) 2020  Christopher J. Howard
+ *
+ * This file is part of Antkeeper source code.
+ *
+ * Antkeeper source code is free software: you can redistribute it and/or modify
+ * it under the terms of the GNU General Public License as published by
+ * the Free Software Foundation, either version 3 of the License, or
+ * (at your option) any later version.
+ *
+ * Antkeeper source code is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Antkeeper source code.  If not, see <http://www.gnu.org/licenses/>.
+ */
+
+#ifndef ANTKEEPER_ECS_CELESTIAL_BODY_COMPONENT_HPP
+#define ANTKEEPER_ECS_CELESTIAL_BODY_COMPONENT_HPP
+
+#include "game/astronomy/celestial-mechanics.hpp"
+#include "utility/fundamental-types.hpp"
+#include "math/quaternion-type.hpp"
+
+namespace ecs {
+
+struct celestial_body_component
+{
+	ast::orbital_elements orbital_elements;
+	ast::orbital_elements orbital_rate;
+	ast::orbital_state orbital_state;
+	
+	double3 position;
+	double3 velocity;
+	double3 acceleration;
+	double mass;
+	double radius;
+	math::quaternion<double> orientation;
+};
+
+struct blackbody_radiator
+{
+	double temperature;
+};
+
+struct diffuse_reflector
+{
+	double albedo;
+};
+
+} // namespace ecs
+
+#endif // ANTKEEPER_ECS_CELESTIAL_BODY_COMPONENT_HPP
diff --git a/src/game/components/orbit-component.hpp b/src/game/components/orbit-component.hpp
index 6468905..812d848 100644
--- a/src/game/components/orbit-component.hpp
+++ b/src/game/components/orbit-component.hpp
@@ -26,26 +26,11 @@ namespace ecs {
 
 struct orbit_component
 {
-	double a;    ///< Semi-major axis, a
-	double d_a;
-	
-	double ec;   ///< Eccentricity, e
-	double d_ec;
-	
-	double w;    ///< Argument of periapsis, w (radians)
-	double d_w;
-	
-	double ma;   ///< Mean anomaly, M (radians)
-	double d_ma;
-	
-	double i;    ///< Inclination, i (radians)
-	double d_i;
-	
-	double om;   ///< Longitude of the ascending node, OMEGA (radians)
-	double d_om;
+	ast::orbital_elements elements;
+	ast::orbital_elements rate;
+	ast::orbital_state state;
 };
 
 } // namespace ecs
 
 #endif // ANTKEEPER_ECS_ORBIT_COMPONENT_HPP
-
diff --git a/src/game/game-context.hpp b/src/game/game-context.hpp
index 9b8c997..affca5f 100644
--- a/src/game/game-context.hpp
+++ b/src/game/game-context.hpp
@@ -88,6 +88,7 @@ class tracking_system;
 class painting_system;
 class weather_system;
 class astronomy_system;
+class solar_system;
 struct biome;
 template <typename T> class animation;
 template <typename T> class material_property;
@@ -246,6 +247,7 @@ struct game_context
 	painting_system* painting_system;
 	weather_system* weather_system;
 	astronomy_system* astronomy_system;
+	solar_system* solar_system;
 	
 	// Game
 	biome* biome;
diff --git a/src/game/states/map-state.cpp b/src/game/states/map-state.cpp
new file mode 100644
index 0000000..da3af23
--- /dev/null
+++ b/src/game/states/map-state.cpp
@@ -0,0 +1,55 @@
+/*
+ * Copyright (C) 2020  Christopher J. Howard
+ *
+ * This file is part of Antkeeper source code.
+ *
+ * Antkeeper source code is free software: you can redistribute it and/or modify
+ * it under the terms of the GNU General Public License as published by
+ * the Free Software Foundation, either version 3 of the License, or
+ * (at your option) any later version.
+ *
+ * Antkeeper source code is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Antkeeper source code.  If not, see <http://www.gnu.org/licenses/>.
+ */
+
+#include "animation/ease.hpp"
+#include "animation/screen-transition.hpp"
+#include "animation/timeline.hpp"
+#include "application.hpp"
+#include "debug/logger.hpp"
+#include "game/game-context.hpp"
+#include "input/input-listener.hpp"
+#include "event/input-events.hpp"
+#include "rasterizer/rasterizer.hpp"
+#include "game/states/game-states.hpp"
+#include "renderer/passes/sky-pass.hpp"
+#include "scene/billboard.hpp"
+#include "scene/scene.hpp"
+#include <functional>
+
+void map_state_enter(game_context* ctx)
+{
+	logger* logger = ctx->logger;	
+	logger->push_task("Entering map state");
+	
+	// Disable sky pass
+	ctx->overworld_sky_pass->set_enabled(false);
+	
+	// Start fade in
+	ctx->fade_transition->transition(1.0f, true, ease<float>::in_quad);
+	
+	logger->pop_task(EXIT_SUCCESS);
+}
+
+void map_state_exit(game_context* ctx)
+{
+	logger* logger = ctx->logger;
+	logger->push_task("Exiting map state");
+	
+	logger->pop_task(EXIT_SUCCESS);
+}
diff --git a/src/game/states/play-state.cpp b/src/game/states/play-state.cpp
index f70302a..b5c3c65 100644
--- a/src/game/states/play-state.cpp
+++ b/src/game/states/play-state.cpp
@@ -56,12 +56,18 @@
 #include "game/systems/render-system.hpp"
 #include "game/systems/tool-system.hpp"
 #include "game/systems/weather-system.hpp"
+#include "game/systems/solar-system.hpp"
 #include "game/systems/astronomy-system.hpp"
 #include "game/biome.hpp"
 #include "utility/fundamental-types.hpp"
 #include "utility/gamma.hpp"
-#include "game/astronomy/celestial-time.hpp"
+
+#include "utility/bit-math.hpp"
+#include "game/genetics/genetics.hpp"
 #include <iostream>
+#include <bitset>
+#include <ctime>
+
 
 void play_state_enter(game_context* ctx)
 {
@@ -84,14 +90,9 @@ void play_state_enter(game_context* ctx)
 	sky_pass->set_sky_model(ctx->resource_manager->load<model>("sky-dome.mdl"));
 	sky_pass->set_moon_model(ctx->resource_manager->load<model>("moon.mdl"));
 	
-	ctx->weather_system->set_location(ctx->biome->location[0], ctx->biome->location[1], ctx->biome->location[2]);
-	ctx->weather_system->set_time(2000, 1, 1, 12, 0, 0.0, 0.0);
-	ctx->weather_system->set_time(0.0);
-	ctx->weather_system->set_sky_palette(ctx->biome->sky_palette);
-	ctx->weather_system->set_sun_palette(ctx->biome->sun_palette);
-	ctx->weather_system->set_ambient_palette(ctx->biome->ambient_palette);
-	ctx->weather_system->set_moon_palette(ctx->biome->moon_palette);
-	ctx->weather_system->set_shadow_palette(ctx->biome->shadow_palette);
+	ctx->weather_system->set_universal_time(0.0);
+	
+	ctx->solar_system->set_universal_time(0.0);
 	
 	ctx->astronomy_system->set_observer_location(double3{4.26352e-5, ctx->biome->location[0], ctx->biome->location[1]});
 	ctx->astronomy_system->set_universal_time(0.0);
@@ -102,23 +103,26 @@ void play_state_enter(game_context* ctx)
 	resource_manager* resource_manager = ctx->resource_manager;
 	entt::registry& ecs_registry = *ctx->ecs_registry;
 	
+	ctx->sun_direct->set_intensity(1.0f);
+	ctx->sun_direct->set_color({1, 1, 1});
+	
 	
 	// Create sun
 	{
 		ecs::orbit_component sun_orbit;
-		sun_orbit.a = 1.0;
-		sun_orbit.ec = 0.016709;
-		sun_orbit.w = math::radians(282.9404);
-		sun_orbit.ma = math::radians(356.0470);
-		sun_orbit.i = 0.0;
-		sun_orbit.om = 0.0;
+		sun_orbit.elements.a = 1.0;
+		sun_orbit.elements.ec = 0.016709;
+		sun_orbit.elements.w = math::radians(282.9404);
+		sun_orbit.elements.ma = math::radians(356.0470);
+		sun_orbit.elements.i = 0.0;
+		sun_orbit.elements.om = 0.0;
 		
-		sun_orbit.d_a = 0.0;
-		sun_orbit.d_ec = -1.151e-9;
-		sun_orbit.d_w = math::radians(4.70935e-5);
-		sun_orbit.d_ma = math::radians(0.9856002585);
-		sun_orbit.d_i = 0.0;
-		sun_orbit.d_om = 0.0;
+		sun_orbit.rate.a = 0.0;
+		sun_orbit.rate.ec = -1.151e-9;
+		sun_orbit.rate.w = math::radians(4.70935e-5);
+		sun_orbit.rate.ma = math::radians(0.9856002585);
+		sun_orbit.rate.i = 0.0;
+		sun_orbit.rate.om = 0.0;
 		
 		ecs::transform_component sun_transform;
 		sun_transform.local = math::identity_transform<float>;
@@ -127,6 +131,8 @@ void play_state_enter(game_context* ctx)
 		auto sun_entity = ecs_registry.create();
 		ecs_registry.assign<ecs::transform_component>(sun_entity, sun_transform);
 		ecs_registry.assign<ecs::orbit_component>(sun_entity, sun_orbit);
+		
+		ctx->astronomy_system->set_sun(sun_entity);
 	}
 	
 	// Create moon
@@ -134,19 +140,19 @@ void play_state_enter(game_context* ctx)
 
 		ecs::orbit_component moon_orbit;
 		
-		moon_orbit.a = 0.00256955529;
-		moon_orbit.ec = 0.0554;
-		moon_orbit.w = math::radians(318.15);
-		moon_orbit.ma = math::radians(135.27);
-		moon_orbit.i = math::radians(5.16);
-		moon_orbit.om = math::radians(125.08);
+		moon_orbit.elements.a = 0.00256955529;
+		moon_orbit.elements.ec = 0.0554;
+		moon_orbit.elements.w = math::radians(318.15);
+		moon_orbit.elements.ma = math::radians(135.27);
+		moon_orbit.elements.i = math::radians(5.16);
+		moon_orbit.elements.om = math::radians(125.08);
 		
-		moon_orbit.d_a = 0.0;
-		moon_orbit.d_ec = 0.0;
-		moon_orbit.d_w = math::radians(0.1643573223);
-		moon_orbit.d_ma = math::radians(13.176358);
-		moon_orbit.d_i = 0.0;
-		moon_orbit.d_om = math::radians(-0.0529538083);
+		moon_orbit.rate.a = 0.0;
+		moon_orbit.rate.ec = 0.0;
+		moon_orbit.rate.w = math::radians(0.1643573223); // Argument of periapsis precession period, P_w
+		moon_orbit.rate.ma = math::radians(13.176358); // Longitude rate, n
+		moon_orbit.rate.i = 0.0;
+		moon_orbit.rate.om = math::radians(-18.6 / 365.2422); // Longitude of the ascending node precession period, P_node
 		
 		ecs::transform_component moon_transform;
 		moon_transform.local = math::identity_transform<float>;
@@ -155,6 +161,8 @@ void play_state_enter(game_context* ctx)
 		auto moon_entity = ecs_registry.create();
 		ecs_registry.assign<ecs::transform_component>(moon_entity, moon_transform);
 		ecs_registry.assign<ecs::orbit_component>(moon_entity, moon_orbit);
+		
+		ctx->astronomy_system->set_moon(moon_entity);
 	}
 
 	// Load entity archetypes
@@ -395,6 +403,61 @@ void play_state_enter(game_context* ctx)
 	
 	std::string biome_name = (*ctx->strings)[ctx->biome->name];
 	logger->log("Entered biome \"" + biome_name + "\"");
+	
+	
+	std::srand(std::time(nullptr));
+	//auto rng = [](){ return std::rand(); };
+	
+	std::random_device rd;
+	std::mt19937 rng(rd());
+	
+	
+	std::string sequence_a = "CCTTGCCCTTTGGGTCGCCCCCCTAG";
+	std::string sequence_b = "ATGTTTCCCGAAGGGTAG";
+	std::string sequence_c = "AAATGCCCCCCCCCCCCCCCCCCCCCCCCCCCTAGAAAAAAAAA";
+	std::string orf_a;
+	std::string protein_a;
+	std::string protein_b;
+	std::string protein_c;
+	
+	
+	std::cout << "sequence a: " << sequence_a << std::endl;
+	genetics::sequence::transcribe(sequence_a.begin(), sequence_a.end(), sequence_a.begin());
+	std::cout << "sequence a: " << sequence_a << std::endl;
+	
+	std::string complement;
+	genetics::sequence::rna::complement(sequence_a.begin(), sequence_a.end(), std::back_inserter(complement));
+	std::cout << "complement: "  << complement << std::endl;
+	
+	auto orf = genetics::sequence::find_orf(sequence_a.begin(), sequence_a.end(), genetics::standard_code);
+	if (orf.start != sequence_a.end())
+	{
+		std::copy(orf.start, orf.stop, std::back_inserter(orf_a));
+		std::cout << "orf      a: " << orf_a << std::endl;
+		
+		genetics::sequence::translate(orf.start, orf.stop, std::back_inserter(protein_a), genetics::standard_code);
+		std::cout << "protein  a: " << protein_a << std::endl;
+	}
+	
+	protein_b = "MFFFFP";
+	protein_c = "MFFFYP";
+	int score;
+
+	std::cout << std::endl;
+	std::cout << "protein_b: " << protein_b << std::endl;
+	std::cout << "protein_c: " << protein_c << std::endl;
+	
+	score = genetics::protein::score(protein_b.begin(), protein_b.end(), protein_c.begin(), genetics::matrix::blosum62<int>);
+	std::cout << "score blosum62: " << score << std::endl;
+	
+	score = genetics::protein::score(protein_b.begin(), protein_b.end(), protein_c.begin(), genetics::matrix::blosum80<int>);
+	std::cout << "score blosum80: " << score << std::endl;
+	
+	
+	std::cout << "identity  : " << genetics::protein::identity<float>(protein_b.begin(), protein_b.end(), protein_c.begin()) << std::endl;
+	std::cout << "similarity62: " << genetics::protein::similarity<float>(protein_b.begin(), protein_b.end(), protein_c.begin(), genetics::matrix::blosum62<int>) << std::endl;
+	std::cout << "similarity80: " << genetics::protein::similarity<float>(protein_b.begin(), protein_b.end(), protein_c.begin(), genetics::matrix::blosum80<int>) << std::endl;
+	
 }
 
 void play_state_exit(game_context* ctx)
diff --git a/src/game/systems/astronomy-system.cpp b/src/game/systems/astronomy-system.cpp
index 5d75c2b..7587724 100644
--- a/src/game/systems/astronomy-system.cpp
+++ b/src/game/systems/astronomy-system.cpp
@@ -19,11 +19,10 @@
 
 #include "game/systems/astronomy-system.hpp"
 #include "game/astronomy/celestial-coordinates.hpp"
-#include "game/astronomy/celestial-mechanics.hpp"
-#include "game/astronomy/celestial-time.hpp"
-#include "game/astronomy/astronomical-constants.hpp"
-#include "game/components/orbit-component.hpp"
+#include "game/astronomy/apparent-size.hpp"
+#include "game/components/celestial-body-component.hpp"
 #include "game/components/transform-component.hpp"
+#include "renderer/passes/sky-pass.hpp"
 
 using namespace ecs;
 
@@ -36,49 +35,51 @@ astronomy_system::astronomy_system(entt::registry& registry):
 	observer_location{0.0, 0.0, 0.0},
 	lst(0.0),
 	obliquity(0.0),
-	ke_tolerance(1e-6),
-	ke_iterations(10)
+	sky_pass(nullptr),
+	sun(entt::null),
+	moon(entt::null)
 {}
 
 void astronomy_system::update(double t, double dt)
 {
-	const double dt_days = dt * days_per_timestep;
-	
 	// Add scaled timestep to current time
-	set_universal_time(universal_time + dt_days);
+	set_universal_time(universal_time + dt * days_per_timestep);
 	
-	// Update horizontal (topocentric) positions of orbiting bodies
-	registry.view<orbit_component, transform_component>().each(
-	[&](auto entity, auto& orbit, auto& transform)
+	// Update horizontal (topocentric) positions of intrasolar celestial bodies
+	registry.view<celestial_body_component, transform_component>().each(
+	[&](auto entity, auto& body, auto& transform)
 	{
-		ast::orbital_elements orbital_elements;
-		orbital_elements.a = orbit.a + orbit.d_a * universal_time;
-		orbital_elements.ec = orbit.ec + orbit.d_ec * universal_time;
-		orbital_elements.w = orbit.w + orbit.d_w * universal_time;
-		orbital_elements.ma = math::wrap_radians(orbit.ma + orbit.d_ma * universal_time);
-		orbital_elements.i = orbit.i + orbit.d_i * universal_time;
-		orbital_elements.om = math::wrap_radians(orbit.om + orbit.d_om * universal_time);
-		
-		// Calculate ecliptic orbital position
-		double3 ecliptic = ast::orbital_elements_to_ecliptic(orbital_elements, ke_tolerance, ke_iterations);
-			
 		// Transform orbital position from ecliptic space to horizontal space
-		double3 horizontal = ecliptic_to_horizontal * ecliptic;
+		double3 horizontal = ecliptic_to_horizontal * body.orbital_state.r;
 		
 		// Subtract observer's radial distance (planet radius + observer's altitude)
 		horizontal.z -= observer_location[0];
 		
-		// Calculate azimuth and elevation
+		// Convert rectangular horizontal coordinates to spherical
 		double3 spherical = ast::rectangular_to_spherical(horizontal);
-		double2 az_el = {spherical.z - math::pi<double>, spherical.y};
+		spherical.z -= math::pi<double>;
+		
+		// Find angular radius
+		double angular_radius = ast::find_angular_radius(body.radius, spherical.x);
 		
 		// Transform into local right-handed coordinates
 		double3 translation = ast::horizontal_to_right_handed * horizontal;
 		double3x3 rotation = ast::horizontal_to_right_handed * ecliptic_to_horizontal;
 		
+		// Set local transform of transform component
 		transform.local.translation = math::type_cast<float>(translation);
 		transform.local.rotation = math::type_cast<float>(math::quaternion_cast(rotation));
+		transform.local.scale = math::type_cast<float>(double3{body.radius, body.radius, body.radius});
 	});
+	
+	if (sky_pass)
+	{
+		sky_pass->set_horizon_color({0, 0, 0});
+		sky_pass->set_zenith_color({1, 1, 1});
+		sky_pass->set_time_of_day(static_cast<float>(universal_time * 60.0 * 60.0));
+		//sky_pass->set_observer_location(location[0], location[1], location[2]);
+		sky_pass->set_julian_day(static_cast<float>(universal_time));
+	}
 }
 
 void astronomy_system::set_universal_time(double time)
@@ -115,6 +116,21 @@ void astronomy_system::set_axial_rotation_at_epoch(double angle)
 	update_axial_rotation();
 }
 
+void astronomy_system::set_sky_pass(::sky_pass* pass)
+{
+	this->sky_pass = pass;
+}
+
+void astronomy_system::set_sun(entt::entity entity)
+{
+	sun = entity;
+}
+
+void astronomy_system::set_moon(entt::entity entity)
+{
+	moon = entity;
+}
+
 void astronomy_system::update_axial_rotation()
 {
 	axial_rotation = math::wrap_radians<double>(axial_rotation_at_epoch + universal_time * axial_rotation_speed);
diff --git a/src/game/systems/astronomy-system.hpp b/src/game/systems/astronomy-system.hpp
index 88b3bf2..5f1f53d 100644
--- a/src/game/systems/astronomy-system.hpp
+++ b/src/game/systems/astronomy-system.hpp
@@ -23,8 +23,10 @@
 #include "entity-system.hpp"
 #include "utility/fundamental-types.hpp"
 
+class sky_pass;
+
 /**
- * 
+ * Calculates apparent properties of celestial bodies relative to an observer (magnitude, angular radius, horizontal coordinates) and modifies their model component and/or light component to render them accordingly.
  */
 class astronomy_system:
 	public entity_system
@@ -33,7 +35,7 @@ public:
 	astronomy_system(entt::registry& registry);
 	
 	/**
-	 * Scales then adds the timestep `dt` to the current Julian date, then recalculates the positions of celestial bodies.
+	 * Scales then adds the timestep `dt` to the current time, then recalculates the positions of celestial bodies.
 	 *
 	 * @param t Time, in seconds.
 	 * @param dt Delta time, in seconds.
@@ -48,7 +50,7 @@ public:
 	void set_universal_time(double time);
 	
 	/**
-	 * Sets the factor by which the timestep `dt` will be scaled before being added to the current Julian date.
+	 * Sets the factor by which the timestep `dt` will be scaled before being added to the current universal time.
 	 *
 	 * @param scale Factor by which to scale the timestep.
 	 */
@@ -61,6 +63,13 @@ public:
 	 */
 	void set_observer_location(const double3& location);
 	
+	/**
+	 * Sets the obliquity of the ecliptic, a.k.a. axial tilt.
+	 *
+	 * @param angle Angle between the planet's rotational axis and its orbital axis, in radians.
+	 */
+	void set_obliquity(double angle);
+	
 	/**
 	 * Sets the rotational speed of the observer's planet.
 	 *
@@ -70,12 +79,10 @@ public:
 	
 	void set_axial_rotation_at_epoch(double angle);
 	
-	/**
-	 * Sets the obliquity of the ecliptic, a.k.a. axial tilt.
-	 *
-	 * @param angle Angle between the planet's rotational axis and its orbital axis, in radians.
-	 */
-	void set_obliquity(double angle);
+	void set_sky_pass(::sky_pass* pass);
+	
+	void set_sun(entt::entity entity);
+	void set_moon(entt::entity entity);
 	
 private:
 	/// Updates the axial rotation angle
@@ -88,16 +95,18 @@ private:
 	void update_ecliptic_to_horizontal();
 	
 	double universal_time;
+	double days_per_timestep;
 	double lst;
 	double axial_rotation_at_epoch;
 	double axial_rotation_speed;
 	double axial_rotation;
-	double days_per_timestep;
 	double3 observer_location;
 	double obliquity;
 	double3x3 ecliptic_to_horizontal;
-	double ke_tolerance;
-	std::size_t ke_iterations;
+	sky_pass* sky_pass;
+	
+	entt::entity sun;
+	entt::entity moon;
 };
 
 #endif // ANTKEEPER_ASTRONOMY_SYSTEM_HPP
diff --git a/src/game/systems/solar-system.cpp b/src/game/systems/solar-system.cpp
new file mode 100644
index 0000000..0aef294
--- /dev/null
+++ b/src/game/systems/solar-system.cpp
@@ -0,0 +1,68 @@
+/*
+ * Copyright (C) 2020  Christopher J. Howard
+ *
+ * This file is part of Antkeeper source code.
+ *
+ * Antkeeper source code is free software: you can redistribute it and/or modify
+ * it under the terms of the GNU General Public License as published by
+ * the Free Software Foundation, either version 3 of the License, or
+ * (at your option) any later version.
+ *
+ * Antkeeper source code is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Antkeeper source code.  If not, see <http://www.gnu.org/licenses/>.
+ */
+
+#include "game/systems/solar-system.hpp"
+#include "game/astronomy/celestial-coordinates.hpp"
+#include "game/astronomy/celestial-mechanics.hpp"
+#include "game/astronomy/astronomical-constants.hpp"
+#include "game/components/celestial-body-component.hpp"
+
+using namespace ecs;
+
+static constexpr double seconds_per_day = 24.0 * 60.0 * 60.0;
+
+solar_system::solar_system(entt::registry& registry):
+	entity_system(registry),
+	universal_time(0.0),
+	days_per_timestep(1.0 / seconds_per_day),
+	ke_tolerance(1e-6),
+	ke_iterations(10)
+{}
+
+void solar_system::update(double t, double dt)
+{
+	// Add scaled timestep to current time
+	set_universal_time(universal_time + dt * days_per_timestep);
+	
+	// Update orbital state of intrasolar celestial bodies
+	registry.view<celestial_body_component>().each(
+	[&](auto entity, auto& body)
+	{
+		ast::orbital_elements elements = body.orbital_elements;
+		elements.a += body.orbital_rate.a * universal_time;
+		elements.ec += body.orbital_rate.ec * universal_time;
+		elements.w += body.orbital_rate.w * universal_time;
+		elements.ma += body.orbital_rate.ma * universal_time;
+		elements.i += body.orbital_rate.i * universal_time;
+		elements.om += body.orbital_rate.om * universal_time;
+		
+		// Calculate ecliptic orbital position
+		body.orbital_state.r = ast::orbital_elements_to_ecliptic(elements, ke_tolerance, ke_iterations);
+	});
+}
+
+void solar_system::set_universal_time(double time)
+{
+	universal_time = time;
+}
+
+void solar_system::set_time_scale(double scale)
+{
+	days_per_timestep = scale / seconds_per_day;
+}
diff --git a/src/game/systems/solar-system.hpp b/src/game/systems/solar-system.hpp
new file mode 100644
index 0000000..4afb7c9
--- /dev/null
+++ b/src/game/systems/solar-system.hpp
@@ -0,0 +1,64 @@
+/*
+ * Copyright (C) 2020  Christopher J. Howard
+ *
+ * This file is part of Antkeeper source code.
+ *
+ * Antkeeper source code is free software: you can redistribute it and/or modify
+ * it under the terms of the GNU General Public License as published by
+ * the Free Software Foundation, either version 3 of the License, or
+ * (at your option) any later version.
+ *
+ * Antkeeper source code is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Antkeeper source code.  If not, see <http://www.gnu.org/licenses/>.
+ */
+
+#ifndef ANTKEEPER_SOLAR_SYSTEM_HPP
+#define ANTKEEPER_SOLAR_SYSTEM_HPP
+
+#include "entity-system.hpp"
+#include "utility/fundamental-types.hpp"
+
+/**
+ * Updates positions, velocities, and rotations of intrasolar celestial bodies.
+ */
+class solar_system:
+	public entity_system
+{
+public:
+	solar_system(entt::registry& registry);
+	
+	/**
+	 * Scales then adds the timestep `dt` to the current time, then recalculates the positions of celestial bodies.
+	 *
+	 * @param t Time, in seconds.
+	 * @param dt Delta time, in seconds.
+	 */
+	virtual void update(double t, double dt);
+	
+	/**
+	 * Sets the current universal time.
+	 *
+	 * @param time Universal time, in days.
+	 */
+	void set_universal_time(double time);
+	
+	/**
+	 * Sets the factor by which the timestep `dt` will be scaled before being added to the current universal time.
+	 *
+	 * @param scale Factor by which to scale the timestep.
+	 */
+	void set_time_scale(double scale);
+	
+private:
+	double universal_time;
+	double days_per_timestep;
+	double ke_tolerance;
+	std::size_t ke_iterations;
+};
+
+#endif // ANTKEEPER_SOLAR_SYSTEM_HPP
diff --git a/src/game/systems/terrain-system.cpp b/src/game/systems/terrain-system.cpp
index 6582915..831f1cb 100644
--- a/src/game/systems/terrain-system.cpp
+++ b/src/game/systems/terrain-system.cpp
@@ -21,6 +21,7 @@
 #include "game/components/model-component.hpp"
 #include "game/components/collision-component.hpp"
 #include "game/components/transform-component.hpp"
+#include "game/cartography/relief-map.hpp"
 #include "renderer/model.hpp"
 #include "geometry/mesh.hpp"
 #include "geometry/mesh-functions.hpp"
@@ -67,102 +68,12 @@ void terrain_system::set_patch_size(float size)
 
 mesh* terrain_system::generate_terrain_mesh(float size, int subdivisions)
 {
-	// Allocate terrain mesh
-	mesh* terrain_mesh = new mesh();
-
-	// Determine vertex count and placement
-	int columns = static_cast<int>(std::pow(2, subdivisions));
-	int rows = columns;
-	int vertex_count = (columns + 1) * (rows + 1);
-	float vertex_increment = size / static_cast<float>(columns);
-	float radius = size * 0.5f;
-
-	// Generate mesh vertices
-	float3 position = {0.0f, 0.0f, -radius};
-	for (int i = 0; i <= rows; ++i)
+	auto elevation = [](float u, float v) -> float
 	{
-		position[0] = -radius;
-
-		for (int j = 0; j <= columns; ++j)
-		{
-			terrain_mesh->add_vertex(position);
-			position[0] += vertex_increment;
-
-		}
-
-		position[2] += vertex_increment;
-	}
-
-
-	// Function to eliminate duplicate edges
-	std::map<std::array<std::size_t, 2>, mesh::edge*> edge_map;
-	auto add_or_find_edge = [&](mesh::vertex* start, mesh::vertex* end) -> mesh::edge*
-	{
-		mesh::edge* edge;
-		if (auto it = edge_map.find({start->index, end->index}); it != edge_map.end())
-		{
-			edge = it->second;
-		}
-		else
-		{
-			edge = terrain_mesh->add_edge(start, end);
-			edge_map[{start->index, end->index}] = edge;
-			edge_map[{end->index, start->index}] = edge->symmetric;
-		}
-
-		return edge;
+		return 0.0f;
 	};
-
-	const std::vector<mesh::vertex*>& vertices = terrain_mesh->get_vertices();
-	for (int i = 0; i < rows; ++i)
-	{
-		for (int j = 0; j < columns; ++j)
-		{
-			mesh::vertex* a = vertices[i * (columns + 1) + j];
-			mesh::vertex* b = vertices[(i + 1) * (columns + 1) + j];
-			mesh::vertex* c = vertices[i * (columns + 1) + j + 1];
-			mesh::vertex* d = vertices[(i + 1) * (columns + 1) + j + 1];
-
-			// +---+---+
-			// | \ | / |
-			// |---+---|
-			// | / | \ |
-			// +---+---+
-			if ((j % 2) == (i % 2))
-			{
-				mesh::edge* ab = add_or_find_edge(a, b);
-				mesh::edge* bd = add_or_find_edge(b, d);
-				mesh::edge* da = add_or_find_edge(d, a);
-
-				mesh::edge* ca = add_or_find_edge(c, a);
-				mesh::edge* ad = da->symmetric;
-				mesh::edge* dc = add_or_find_edge(d, c);
-
-				// a---c
-				// | \ |
-				// b---d
-				terrain_mesh->add_face({ab, bd, da});
-				terrain_mesh->add_face({ca, ad, dc});
-			}
-			else
-			{
-				mesh::edge* ab = add_or_find_edge(a, b);
-				mesh::edge* bc = add_or_find_edge(b, c);
-				mesh::edge* ca = add_or_find_edge(c, a);
-				mesh::edge* cb = bc->symmetric;
-				mesh::edge* bd = add_or_find_edge(b, d);
-				mesh::edge* dc = add_or_find_edge(d, c);
-
-				// a---c
-				// | / |
-				// b---d
-				terrain_mesh->add_face({ab, bc, ca});
-				terrain_mesh->add_face({cb, bd, dc});
-			}
-		}
-	}
-
-	return terrain_mesh;
+	
+	return cart::map_elevation(elevation, size, subdivisions);
 }
 
 model* terrain_system::generate_terrain_model(mesh* terrain_mesh)
@@ -385,4 +296,3 @@ void terrain_system::on_terrain_destroy(entt::registry& registry, entt::entity e
 	}
 	*/
 }
-
diff --git a/src/game/systems/weather-system.cpp b/src/game/systems/weather-system.cpp
index 69838fd..6386cd3 100644
--- a/src/game/systems/weather-system.cpp
+++ b/src/game/systems/weather-system.cpp
@@ -27,284 +27,47 @@
 #include "resources/image.hpp"
 #include "game/astronomy/celestial-coordinates.hpp"
 #include "game/astronomy/celestial-mechanics.hpp"
-#include "game/astronomy/celestial-time.hpp"
 #include <cmath>
 
-static constexpr double hours_per_day = 24.0;
-static constexpr double minutes_per_day = hours_per_day * 60.0;
-static constexpr double seconds_per_day = minutes_per_day * 60.0;
+static constexpr double seconds_per_day = 24.0 * 60.0 * 60.0;
 
 weather_system::weather_system(entt::registry& registry):
 	entity_system(registry),
-	ambient_light(nullptr),
-	sun_light(nullptr),
-	moon_light(nullptr),
-	shadow_light(nullptr),
 	sky_pass(nullptr),
 	shadow_map_pass(nullptr),
 	material_pass(nullptr),
-	time_scale(1.0f),
-	sun_direction{0.0f, -1.0f, 0.0f},
-	location{0.0f, 0.0f, 0.0f},
-	jd(0.0)
+	universal_time(0.0),
+	days_per_timestep(1.0 / seconds_per_day)
 {}
 
 void weather_system::update(double t, double dt)
 {
-	jd += (dt * time_scale) / seconds_per_day;
-	
-	const float latitude = location[0];
-	const float longitude = location[1];
-	
-	// Calculate local time
-	double time_correction = longitude / (math::two_pi<double> / 24.0);
-	double local_jd = jd + time_correction / 24.0 - 0.5;
-	double local_time = (local_jd - std::floor(local_jd)) * 24.0;
-	
-	double lmst = ast::jd_to_lmst(jd, longitude);
-	double ecl = ast::approx_ecliptic_obliquity(jd);
-	double3x3 ecliptic_to_horizontal = ast::ecliptic_to_horizontal(ecl, latitude, lmst);
-
-	
-	double3 sun_ecliptic = ast::approx_sun_ecliptic(jd);
-	double3 sun_horizontal = ecliptic_to_horizontal * sun_ecliptic;
-	sun_horizontal.z -= 4.25875e-5; // Subtract one earth radius (in AU), for positon of observer
-	double3 sun_spherical = ast::rectangular_to_spherical(sun_horizontal);
-	double3 sun_positiond = ast::horizontal_to_right_handed * sun_horizontal;
-	float2 sun_az_el = {static_cast<float>(sun_spherical.z) - math::pi<float>, static_cast<float>(sun_spherical.y)};
-	float3 sun_position = math::normalize(float3{static_cast<float>(sun_positiond.x), static_cast<float>(sun_positiond.y), static_cast<float>(sun_positiond.z)});
-	
-	
-	double3 moon_ecliptic = ast::approx_moon_ecliptic(jd);
-	double3 moon_horizontal = ecliptic_to_horizontal * moon_ecliptic;
-	moon_horizontal.z -= 1.0; // Subtract one earth radius, for position of observer
-	
-	double3 moon_spherical = ast::rectangular_to_spherical(moon_horizontal);
-	double3 moon_positiond = ast::horizontal_to_right_handed * moon_horizontal;
-	float2 moon_az_el = {static_cast<float>(moon_spherical.z) - math::pi<float>, static_cast<float>(moon_spherical.y)};	
-	float3 moon_position = math::normalize(math::type_cast<float>(moon_positiond));
-	
-	double3x3 moon_rotation_matrix = ast::horizontal_to_right_handed * ecliptic_to_horizontal;
-	math::quaternion<double> moon_rotationd = math::normalize(math::quaternion_cast(moon_rotation_matrix) * math::angle_axis(math::half_pi<double>, double3{0, 1, 0}) * math::angle_axis(-math::half_pi<double>, double3{0, 0, -1}));
-	math::quaternion<float> moon_rotation =
-	{
-		static_cast<float>(moon_rotationd.w),
-		static_cast<float>(moon_rotationd.x),
-		static_cast<float>(moon_rotationd.y),
-		static_cast<float>(moon_rotationd.z)
-	};
-	
-	if (sun_light)
-	{
-		math::quaternion<float> sun_azimuth_rotation = math::angle_axis(sun_az_el[0], float3{0, 1, 0});
-		math::quaternion<float> sun_elevation_rotation = math::angle_axis(sun_az_el[1], float3{-1, 0, 0});
-		math::quaternion<float> sun_az_el_rotation = math::normalize(sun_azimuth_rotation * sun_elevation_rotation);
-		sun_light->set_rotation(sun_az_el_rotation);
-	}
-	
-	if (moon_light)
-	{
-		math::quaternion<float> moon_azimuth_rotation = math::angle_axis(moon_az_el[0], float3{0, 1, 0});
-		math::quaternion<float> moon_elevation_rotation = math::angle_axis(moon_az_el[1], float3{-1, 0, 0});
-		math::quaternion<float> moon_az_el_rotation = math::normalize(moon_azimuth_rotation * moon_elevation_rotation);
-		moon_light->set_rotation(moon_az_el_rotation);
-	}
-	
-	float sun_gradient_position = static_cast<float>(std::max<double>(0.0, ((sun_az_el[1] + math::half_pi<double>) / math::pi<double>)));
-	float moon_gradient_position = static_cast<float>(std::max<double>(0.0, ((moon_az_el[1] + math::half_pi<double>) / math::pi<double>)));
-	float sky_gradient_position = sun_gradient_position;
-	float ambient_gradient_position = sun_gradient_position;
-	
-	if (sky_pass)
-	{
-		if (sun_light)
-		{
-			float3 sun_color = interpolate_gradient(sun_colors, sun_gradient_position);
-			sun_light->set_color(sun_color);
-			sun_light->set_intensity(1.0f);
-		}
-		
-		if (moon_light)
-		{
-			float3 moon_color = interpolate_gradient(moon_colors, moon_gradient_position);
-			moon_light->set_color(moon_color);
-			moon_light->set_intensity(1.0f);
-		}
-		
-		if (ambient_light)
-		{
-			float3 ambient_color = interpolate_gradient(ambient_colors, ambient_gradient_position);
-			ambient_light->set_color(ambient_color);
-			ambient_light->set_intensity(0.5f);
-		}
-		
-		float3 horizon_color = interpolate_gradient(horizon_colors, sun_gradient_position);
-		float3 zenith_color = interpolate_gradient(zenith_colors, sun_gradient_position);
-		sky_pass->set_horizon_color(horizon_color);
-		sky_pass->set_zenith_color(zenith_color);
-		sky_pass->set_time_of_day(static_cast<float>(local_time * 60.0 * 60.0));
-		sky_pass->set_observer_location(location[0], location[1], location[2]);
-		sky_pass->set_sun_coordinates(sun_position, sun_az_el);
-		sky_pass->set_moon_coordinates(moon_position, moon_az_el);
-		sky_pass->set_julian_day(static_cast<float>(jd));
-		sky_pass->set_moon_rotation(moon_rotation);
-	}
-	
-	shadow_light = sun_light;
-	if (shadow_map_pass)
-	{
-		if (sun_az_el[1] < 0.0f)
-		{
-			shadow_map_pass->set_light(moon_light);
-		}
-		else
-		{
-			shadow_map_pass->set_light(sun_light);
-		}
-	}
-	
-	if (material_pass)
-	{
-		float shadow_strength = interpolate_gradient(shadow_strengths, sun_gradient_position).x;
-		material_pass->set_shadow_strength(shadow_strength);
-	}
-}
-
-void weather_system::set_location(float latitude, float longitude, float altitude)
-{
-	location = {latitude, longitude, altitude};
-}
-
-void weather_system::set_ambient_light(::ambient_light* light)
-{
-	ambient_light = light;
-}
-
-void weather_system::set_sun_light(directional_light* light)
-{
-	sun_light = light;
-}
-
-void weather_system::set_moon_light(directional_light* light)
-{
-	moon_light = light;
+	// Add scaled timestep to current time
+	set_universal_time(universal_time + dt * days_per_timestep);
 }
 
 void weather_system::set_sky_pass(::sky_pass* pass)
 {
 	sky_pass = pass;
-	
-	if (sky_pass)
-	{
-		sky_pass->set_moon_angular_radius(math::radians(1.0f));
-		sky_pass->set_sun_angular_radius(math::radians(1.1f));
-	}
 }
 
 void weather_system::set_shadow_map_pass(::shadow_map_pass* pass)
 {
 	shadow_map_pass = pass;
-	
-	if (shadow_map_pass)
-	{
-		shadow_map_pass->set_light(shadow_light);
-	}
 }
 
 void weather_system::set_material_pass(::material_pass* pass)
 {
 	material_pass = pass;
+	material_pass->set_shadow_strength(0.5f);
 }
 
-void weather_system::set_time(int year, int month, int day, int hour, int minute, double second, double tc)
-{
-	jd = ast::ut_to_jd(year, month, day, hour, minute, second) - tc / 24.0;
-}
-
-void weather_system::set_time(double time)
-{
-	jd = time + 2451545.0;
-}
-
-void weather_system::set_time_scale(float scale)
-{
-	time_scale = scale;
-}
-
-void weather_system::set_sky_palette(const ::image* image)
-{
-	load_palette(&horizon_colors, image, 0);
-	load_palette(&zenith_colors, image, 1);
-}
-
-void weather_system::set_sun_palette(const ::image* image)
-{
-	load_palette(&sun_colors, image, 0);
-}
-
-void weather_system::set_moon_palette(const ::image* image)
-{
-	load_palette(&moon_colors, image, 0);
-}
-
-void weather_system::set_ambient_palette(const ::image* image)
-{
-	load_palette(&ambient_colors, image, 0);
-}
-
-void weather_system::set_shadow_palette(const ::image* image)
-{
-	load_palette(&shadow_strengths, image, 0);
-}
-
-void weather_system::load_palette(std::vector<float3>* palette, const ::image* image, unsigned int row)
+void weather_system::set_universal_time(double time)
 {
-	unsigned int w = image->get_width();
-	unsigned int h = image->get_height();
-	unsigned int c = image->get_channels();
-	unsigned int y = std::min<unsigned int>(row, h - 1);
-	
-	palette->clear();
-	
-	if (image->is_hdr())
-	{
-		const float* pixels = static_cast<const float*>(image->get_pixels());
-		
-		for (unsigned int x = 0; x < w; ++x)
-		{
-			unsigned int i = y * w * c + x * c;
-			
-			float r = pixels[i];
-			float g = pixels[i + 1];
-			float b = pixels[i + 2];
-			
-			palette->push_back(float3{r, g, b});
-		}
-	}
-	else
-	{
-		const unsigned char* pixels = static_cast<const unsigned char*>(image->get_pixels());
-		
-		for (unsigned int x = 0; x < w; ++x)
-		{
-			unsigned int i = y * w * c + x * c;
-			
-			float r = srgb_to_linear(static_cast<float>(pixels[i]) / 255.0f);
-			float g = srgb_to_linear(static_cast<float>(pixels[i + 1]) / 255.0f);
-			float b = srgb_to_linear(static_cast<float>(pixels[i + 2]) / 255.0f);
-			
-			palette->push_back(float3{r, g, b});
-		}
-	}
+	universal_time = time;
 }
 
-float3 weather_system::interpolate_gradient(const std::vector<float3>& gradient, float position)
+void weather_system::set_time_scale(double scale)
 {
-	if (gradient.empty())
-		return float3{0.0f, 0.0f, 0.0f};
-	
-	position *= static_cast<float>(gradient.size() - 1);
-	int index0 = static_cast<int>(position) % gradient.size();
-	int index1 = (index0 + 1) % gradient.size();
-	return math::lerp<float3>(gradient[index0], gradient[index1], position - std::floor(position));
+	days_per_timestep = scale / seconds_per_day;
 }
diff --git a/src/game/systems/weather-system.hpp b/src/game/systems/weather-system.hpp
index c9bffaf..b5dc06a 100644
--- a/src/game/systems/weather-system.hpp
+++ b/src/game/systems/weather-system.hpp
@@ -45,45 +45,33 @@ public:
 	 */
 	void set_location(float latitude, float longitude, float altitude);
 	
-	void set_ambient_light(ambient_light* light);
-	void set_sun_light(directional_light* light);
-	void set_moon_light(directional_light* light);
 	void set_sky_pass(::sky_pass* pass);
 	void set_shadow_map_pass(::shadow_map_pass* pass);
 	void set_material_pass(::material_pass* pass);
 	
-	/// @param tc Timezone correction, in hours
-	void set_time(int year, int month, int day, int hour, int minute, double second, double tc);
-	void set_time(double time);
-	void set_time_scale(float scale);
+	/**
+	 * Sets the current universal time.
+	 *
+	 * @param time Universal time, in days.
+	 */
+	void set_universal_time(double time);
 	
-	void set_sky_palette(const ::image* image);
-	void set_sun_palette(const ::image* image);
-	void set_moon_palette(const ::image* image);
-	void set_ambient_palette(const ::image* image);
-	void set_shadow_palette(const ::image* image);
+	/**
+	 * Sets the factor by which the timestep `dt` will be scaled before being added to the current universal time.
+	 *
+	 * @param scale Factor by which to scale the timestep.
+	 */
+	void set_time_scale(double scale);
 	
 private:
 	static void load_palette(std::vector<float3>* palette, const ::image* image, unsigned int row);
 	static float3 interpolate_gradient(const std::vector<float3>& gradient, float position);
 
-	double jd;
-	float3 location;
-	float time_scale;
-	float3 sun_direction;
-	ambient_light* ambient_light;
-	directional_light* sun_light;
-	directional_light* moon_light;
-	directional_light* shadow_light;
+	double universal_time;
+	double days_per_timestep;
 	sky_pass* sky_pass;
 	shadow_map_pass* shadow_map_pass;
 	material_pass* material_pass;
-	std::vector<float3> sun_colors;
-	std::vector<float3> moon_colors;
-	std::vector<float3> ambient_colors;
-	std::vector<float3> shadow_strengths;
-	std::vector<float3> horizon_colors;
-	std::vector<float3> zenith_colors;
 };
 
 #endif // ANTKEEPER_WEATHER_SYSTEM_HPP