diff --git a/CMakeLists.txt b/CMakeLists.txt
index d4aa351..af368e1 100644
--- a/CMakeLists.txt
+++ b/CMakeLists.txt
@@ -1,5 +1,6 @@
 cmake_minimum_required(VERSION 3.7)
 
+
 option(VERSION_STRING "Project version string" "0.0.0")
 
 project(antkeeper VERSION ${VERSION_STRING} LANGUAGES CXX)
diff --git a/src/application.cpp b/src/application.cpp
index edfec4f..21f7c16 100644
--- a/src/application.cpp
+++ b/src/application.cpp
@@ -39,7 +39,8 @@
 application::application():
 	closed(false),
 	exit_status(EXIT_SUCCESS),
-	state({nullptr, nullptr}),
+	current_state{std::string(), nullptr, nullptr},
+	queued_state{std::string(), nullptr, nullptr},
 	update_callback(nullptr),
 	render_callback(nullptr),
 	fullscreen(true),
@@ -277,27 +278,69 @@ int application::execute(bootloader_type bootloader)
 	}
 	
 	// Exit current state
-	change_state({nullptr, nullptr});
+	change_state({std::string(), nullptr, nullptr});
 	
 	return exit_status;
 }
 
-void application::change_state(const state_type& next_state)
+void application::change_state(const application::state& next_state)
 {
 	// Exit current state
-	if (state[1])
+	if (current_state.exit)
 	{
-		state[1]();
+		logger->push_task("Exiting application state \"" + current_state.name + "\"");
+		
+		try
+		{
+			current_state.exit();
+		}
+		catch (...)
+		{
+			logger->pop_task(EXIT_FAILURE);
+			throw;
+		}
+		logger->pop_task(EXIT_SUCCESS);
 	}
 	
+	current_state = next_state;
+	
 	// Enter next state
-	state = next_state;
-	if (state[0])
+	if (current_state.enter)
 	{
-		state[0]();
+		logger->push_task("Entering application state \"" + current_state.name + "\"");
+		
+		try
+		{
+			current_state.enter();
+		}
+		catch (...)
+		{
+			logger->pop_task(EXIT_FAILURE);
+			throw;
+		}
+		logger->pop_task(EXIT_SUCCESS);
+	}
+	
+	// Enter queued state (if any)
+	if (queued_state.enter != nullptr || queued_state.exit != nullptr)
+	{
+		// Make a copy of the queued state
+		application::state queued_state_copy = queued_state;
+		
+		// Clear the queued state
+		queued_state = {std::string(), nullptr, nullptr};
+		
+		// Enter the queued state
+		change_state(queued_state_copy);
 	}
 }
 
+void application::queue_state(const application::state& next_state)
+{
+	queued_state = next_state;
+	logger->log("Queued application state \"" + queued_state.name + "\"");
+}
+
 std::shared_ptr<image> application::capture_frame() const
 {
 	int w = viewport_dimensions[0];
diff --git a/src/application.hpp b/src/application.hpp
index 8c0b934..43ca4d2 100644
--- a/src/application.hpp
+++ b/src/application.hpp
@@ -49,7 +49,19 @@ namespace debug
 class application
 {
 public:
-	typedef std::array<std::function<void()>, 2> state_type;
+	/// Application state type.
+	struct state
+	{
+		/// Name of the state.
+		std::string name;
+		
+		/// State enter function.
+		std::function<void()> enter;
+		
+		/// State exit function.
+		std::function<void()> exit;
+	};
+	
 	typedef std::function<int(application*)> bootloader_type;
 	typedef std::function<void(double, double)> update_callback_type;
 	typedef std::function<void(double)> render_callback_type;
@@ -83,9 +95,16 @@ public:
 	/**
 	 * Changes the applications state, resulting in the execution of the current state's exit function (if any), followed by the new state's enter function (if any).
 	 *
-	 * @param state A pair of enter and exit functions, respectively, which define the state.
+	 * @param next_state Next application state.
+	 */
+	void change_state(const application::state& next_state);
+	
+	/**
+	 * Queues the next applications state. This may be called from within a state's enter function.
+	 *
+	 * @param next_state Next application state.
 	 */
-	void change_state(const state_type& state);
+	void queue_state(const application::state& next_state);
 	
 	/**
 	 * Captures a screenshot of the most recently rendered frame.
@@ -206,7 +225,8 @@ private:
 	
 	bool closed;
 	int exit_status;
-	state_type state;
+	application::state current_state;
+	application::state queued_state;
 	update_callback_type update_callback;
 	render_callback_type render_callback;
 	bool fullscreen;
diff --git a/src/debug/console-commands.cpp b/src/debug/console-commands.cpp
index 79b9f43..857adef 100644
--- a/src/debug/console-commands.cpp
+++ b/src/debug/console-commands.cpp
@@ -20,7 +20,6 @@
 #include "console-commands.hpp"
 #include "application.hpp"
 #include "animation/timeline.hpp"
-#include "game/game-context.hpp"
 #include "debug/cli.hpp"
 
 namespace debug {
@@ -31,19 +30,19 @@ std::string echo(std::string text)
 	return text;
 }
 
-std::string exit(game_context* ctx)
+std::string exit(game::context* ctx)
 {
 	ctx->app->close(EXIT_SUCCESS);
 	return std::string();
 }
 
-std::string scrot(game_context* ctx)
+std::string scrot(game::context* ctx)
 {
 	//ctx->app->take_screenshot();
 	return std::string("screenshot saved");
 }
 
-std::string cue(game_context* ctx, float t, std::string command)
+std::string cue(game::context* ctx, float t, std::string command)
 {
 	::timeline* timeline = ctx->timeline;
 	debug::cli* cli = ctx->cli;
diff --git a/src/debug/console-commands.hpp b/src/debug/console-commands.hpp
index 17bbaa5..39cc28e 100644
--- a/src/debug/console-commands.hpp
+++ b/src/debug/console-commands.hpp
@@ -20,10 +20,9 @@
 #ifndef ANTKEEPER_DEBUG_CONSOLE_COMMANDS_HPP
 #define ANTKEEPER_DEBUG_CONSOLE_COMMANDS_HPP
 
+#include "game/context.hpp"
 #include <string>
 
-struct game_context;
-
 namespace debug {
 
 /// Console commands
@@ -31,11 +30,11 @@ namespace cc {
 
 std::string echo(std::string text);
 
-std::string exit(game_context* ctx);
+std::string exit(game::context* ctx);
 
-std::string scrot(game_context* ctx);
+std::string scrot(game::context* ctx);
 
-std::string cue(game_context* ctx, float t, std::string command);
+std::string cue(game::context* ctx, float t, std::string command);
 
 } // namespace cc
 } // namespace debug
diff --git a/src/game/bootloader.cpp b/src/game/bootloader.cpp
index 323513d..8228541 100644
--- a/src/game/bootloader.cpp
+++ b/src/game/bootloader.cpp
@@ -26,7 +26,7 @@
 #include "debug/cli.hpp"
 #include "debug/console-commands.hpp"
 #include "debug/logger.hpp"
-#include "game/game-context.hpp"
+#include "game/context.hpp"
 #include "gl/framebuffer.hpp"
 #include "gl/pixel-format.hpp"
 #include "gl/pixel-type.hpp"
@@ -54,7 +54,7 @@
 #include "resources/resource-manager.hpp"
 #include "resources/resource-manager.hpp"
 #include "scene/scene.hpp"
-#include "game/states/game-states.hpp"
+#include "game/states/loading.hpp"
 #include "entity/systems/behavior.hpp"
 #include "entity/systems/camera.hpp"
 #include "entity/systems/collision.hpp"
@@ -102,19 +102,19 @@
 
 static constexpr double seconds_per_day = 24.0 * 60.0 * 60.0;
 
-static void parse_options(game_context* ctx, int argc, char** argv);
-static void setup_resources(game_context* ctx);
-static void load_config(game_context* ctx);
-static void load_strings(game_context* ctx);
-static void setup_window(game_context* ctx);
-static void setup_rendering(game_context* ctx);
-static void setup_scenes(game_context* ctx);
-static void setup_animation(game_context* ctx);
-static void setup_entities(game_context* ctx);
-static void setup_systems(game_context* ctx);
-static void setup_controls(game_context* ctx);
-static void setup_cli(game_context* ctx);
-static void setup_callbacks(game_context* ctx);
+static void parse_options(game::context* ctx, int argc, char** argv);
+static void setup_resources(game::context* ctx);
+static void load_config(game::context* ctx);
+static void load_strings(game::context* ctx);
+static void setup_window(game::context* ctx);
+static void setup_rendering(game::context* ctx);
+static void setup_scenes(game::context* ctx);
+static void setup_animation(game::context* ctx);
+static void setup_entities(game::context* ctx);
+static void setup_systems(game::context* ctx);
+static void setup_controls(game::context* ctx);
+static void setup_cli(game::context* ctx);
+static void setup_callbacks(game::context* ctx);
 
 int bootloader(application* app, int argc, char** argv)
 {
@@ -124,7 +124,7 @@ int bootloader(application* app, int argc, char** argv)
 	logger->push_task("Running application bootloader");
 	
 	// Allocate game context
-	game_context* ctx = new game_context();
+	game::context* ctx = new game::context();
 	ctx->app = app;
 	ctx->logger = logger;
 	
@@ -154,16 +154,19 @@ int bootloader(application* app, int argc, char** argv)
 	
 	logger->pop_task(EXIT_SUCCESS);
 	
-	// Change state
-	if (ctx->option_quick_start.has_value())
-		app->change_state({std::bind(play_state_enter, ctx), std::bind(play_state_exit, ctx)});
-	else
-		app->change_state({std::bind(splash_state_enter, ctx), std::bind(splash_state_exit, ctx)});
+	// Setup initial application state
+	application::state initial_state;
+	initial_state.name = "loading";
+	initial_state.enter = std::bind(game::state::loading::enter, ctx);
+	initial_state.exit = std::bind(game::state::loading::exit, ctx);
+	
+	// Enter initial application state
+	app->change_state(initial_state);
 	
 	return EXIT_SUCCESS;
 }
 
-void parse_options(game_context* ctx, int argc, char** argv)
+void parse_options(game::context* ctx, int argc, char** argv)
 {
 	debug::logger* logger = ctx->logger;
 	logger->push_task("Parsing command line options");
@@ -229,7 +232,7 @@ void parse_options(game_context* ctx, int argc, char** argv)
 	logger->pop_task(EXIT_SUCCESS);
 }
 
-void setup_resources(game_context* ctx)
+void setup_resources(game::context* ctx)
 {
 	debug::logger* logger = ctx->logger;
 	
@@ -352,7 +355,7 @@ void setup_resources(game_context* ctx)
 	ctx->resource_manager->include("/");
 }
 
-void load_config(game_context* ctx)
+void load_config(game::context* ctx)
 {
 	debug::logger* logger = ctx->logger;
 	logger->push_task("Loading config");
@@ -368,7 +371,7 @@ void load_config(game_context* ctx)
 	logger->pop_task(EXIT_SUCCESS);
 }
 
-void load_strings(game_context* ctx)
+void load_strings(game::context* ctx)
 {
 	debug::logger* logger = ctx->logger;
 	logger->push_task("Loading strings");
@@ -392,7 +395,7 @@ void load_strings(game_context* ctx)
 	logger->pop_task(EXIT_SUCCESS);
 }
 
-void setup_window(game_context* ctx)
+void setup_window(game::context* ctx)
 {
 	debug::logger* logger = ctx->logger;
 	logger->push_task("Setting up window");
@@ -439,7 +442,7 @@ void setup_window(game_context* ctx)
 	logger->pop_task(EXIT_SUCCESS);
 }
 
-void setup_rendering(game_context* ctx)
+void setup_rendering(game::context* ctx)
 {
 	debug::logger* logger = ctx->logger;
 	logger->push_task("Setting up rendering");
@@ -505,7 +508,7 @@ void setup_rendering(game_context* ctx)
 	ctx->overworld_clear_pass->set_clear_depth(0.0f);
 	ctx->overworld_sky_pass = new sky_pass(ctx->rasterizer, ctx->framebuffer_hdr, ctx->resource_manager);
 	ctx->app->get_event_dispatcher()->subscribe<mouse_moved_event>(ctx->overworld_sky_pass);
-	ctx->overworld_sky_pass->set_enabled(false);
+	ctx->overworld_sky_pass->set_enabled(true);
 	ctx->overworld_material_pass = new material_pass(ctx->rasterizer, ctx->framebuffer_hdr, ctx->resource_manager);
 	ctx->overworld_material_pass->set_fallback_material(ctx->fallback_material);
 	ctx->overworld_material_pass->shadow_map_pass = ctx->overworld_shadow_map_pass;
@@ -601,7 +604,7 @@ void setup_rendering(game_context* ctx)
 	logger->pop_task(EXIT_SUCCESS);
 }
 
-void setup_scenes(game_context* ctx)
+void setup_scenes(game::context* ctx)
 {
 	debug::logger* logger = ctx->logger;
 	logger->push_task("Setting up scenes");
@@ -720,7 +723,7 @@ void setup_scenes(game_context* ctx)
 	logger->pop_task(EXIT_SUCCESS);
 }
 
-void setup_animation(game_context* ctx)
+void setup_animation(game::context* ctx)
 {
 	// Setup timeline system
 	ctx->timeline = new timeline();
@@ -736,6 +739,8 @@ void setup_animation(game_context* ctx)
 	// Create fade transition
 	ctx->fade_transition = new screen_transition();
 	ctx->fade_transition->get_material()->set_shader_program(ctx->resource_manager->load<gl::shader_program>("fade-transition.glsl"));
+	ctx->fade_transition_color = ctx->fade_transition->get_material()->add_property<float3>("color");
+	ctx->fade_transition_color->set_value({0, 0, 0});
 	ctx->ui_scene->add_object(ctx->fade_transition->get_billboard());
 	ctx->animator->add_animation(ctx->fade_transition->get_animation());
 	
@@ -767,7 +772,7 @@ void setup_animation(game_context* ctx)
 	ctx->ui_material_pass->set_time_tween(ctx->time_tween);
 }
 
-void setup_entities(game_context* ctx)
+void setup_entities(game::context* ctx)
 {
 	// Create entity registry
 	ctx->entity_registry = new entt::registry();
@@ -783,7 +788,7 @@ void setup_entities(game_context* ctx)
 	ctx->focal_point_entity = ctx->entity_registry->create();
 }
 
-void setup_systems(game_context* ctx)
+void setup_systems(game::context* ctx)
 {
 	event_dispatcher* event_dispatcher = ctx->app->get_event_dispatcher();
 
@@ -878,6 +883,7 @@ void setup_systems(game_context* ctx)
 	
 	// Setup astronomy system
 	ctx->astronomy_system = new entity::system::astronomy(*ctx->entity_registry);
+	ctx->astronomy_system->set_sky_pass(ctx->overworld_sky_pass);
 	
 	// Setup proteome system
 	ctx->proteome_system = new entity::system::proteome(*ctx->entity_registry);
@@ -923,7 +929,7 @@ void setup_systems(game_context* ctx)
 	event_dispatcher->subscribe<window_resized_event>(ctx->ui_system);
 }
 
-void setup_controls(game_context* ctx)
+void setup_controls(game::context* ctx)
 {
 	event_dispatcher* event_dispatcher = ctx->app->get_event_dispatcher();
 	
@@ -1227,7 +1233,7 @@ void setup_controls(game_context* ctx)
 
 }
 
-void setup_cli(game_context* ctx)
+void setup_cli(game::context* ctx)
 {
 	ctx->cli = new debug::cli();
 	ctx->cli->register_command("echo", debug::cc::echo);
@@ -1239,7 +1245,7 @@ void setup_cli(game_context* ctx)
 	//logger->log(cli.interpret(cmd));
 }
 
-void setup_callbacks(game_context* ctx)
+void setup_callbacks(game::context* ctx)
 {
 	// Set update callback
 	ctx->app->set_update_callback
diff --git a/src/game/game-context.hpp b/src/game/context.hpp
similarity index 96%
rename from src/game/game-context.hpp
rename to src/game/context.hpp
index df64b71..d492ad8 100644
--- a/src/game/game-context.hpp
+++ b/src/game/context.hpp
@@ -41,6 +41,7 @@
 #include <entt/entt.hpp>
 #include <fstream>
 #include <string>
+#include <unordered_map>
 
 // Forward declarations
 class animator;
@@ -103,10 +104,10 @@ namespace entity
 	}
 }
 
-/**
- * 
- */
-struct game_context
+namespace game {
+
+/// Structure containing the state of a game.
+struct context
 {
 	application* app;
 	debug::logger* logger;
@@ -205,6 +206,7 @@ struct game_context
 	animation<float>* radial_transition_in;
 	animation<float>* radial_transition_out;
 	screen_transition* fade_transition;
+	material_property<float3>* fade_transition_color;
 	screen_transition* radial_transition_inner;
 	screen_transition* radial_transition_outer;
 	animation<float>* equip_tool_animation;
@@ -257,6 +259,7 @@ struct game_context
 	entity::system::astronomy* astronomy_system;
 	entity::system::orbit* orbit_system;
 	entity::system::proteome* proteome_system;
+	std::unordered_map<std::string, entity::id> named_entities;
 	
 	// Game
 	biome* biome;
@@ -268,4 +271,6 @@ struct game_context
 	pheromone_matrix* pheromones;
 };
 
+} // namespace game
+
 #endif // ANTKEEPER_GAME_CONTEXT_HPP
diff --git a/src/game/states/loading.cpp b/src/game/states/loading.cpp
new file mode 100644
index 0000000..29cc9c0
--- /dev/null
+++ b/src/game/states/loading.cpp
@@ -0,0 +1,268 @@
+/*
+ * Copyright (C) 2021  Christopher J. Howard
+ *
+ * This file is part of Antkeeper source code.
+ *
+ * Antkeeper source code is free software: you can redistribute it and/or modify
+ * it under the terms of the GNU General Public License as published by
+ * the Free Software Foundation, either version 3 of the License, or
+ * (at your option) any later version.
+ *
+ * Antkeeper source code is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Antkeeper source code.  If not, see <http://www.gnu.org/licenses/>.
+ */
+
+#include "game/states/loading.hpp"
+#include "game/states/play.hpp"
+#include "game/states/splash.hpp"
+#include "entity/components/celestial-body.hpp"
+#include "entity/components/orbit.hpp"
+#include "entity/components/blackbody.hpp"
+#include "entity/components/terrain.hpp"
+#include "entity/components/atmosphere.hpp"
+#include "entity/components/transform.hpp"
+#include "entity/systems/astronomy.hpp"
+#include "entity/systems/orbit.hpp"
+#include "scene/directional-light.hpp"
+#include "scene/ambient-light.hpp"
+#include "resources/resource-manager.hpp"
+#include "application.hpp"
+#include "renderer/passes/shadow-map-pass.hpp"
+
+namespace game {
+namespace state {
+namespace loading {
+
+/// Creates the universe and solar system.
+static void cosmogenesis(game::context* ctx);
+
+/// Creates a sun.
+static void heliogenesis(game::context* ctx);
+
+/// Creates a planet.
+static void planetogenesis(game::context* ctx);
+
+/// Creates a moon.
+static void selenogenesis(game::context* ctx);
+
+void enter(game::context* ctx)
+{
+	// Create universe
+	ctx->logger->push_task("Creating the universe");
+	try
+	{
+		cosmogenesis(ctx);
+	}
+	catch (...)
+	{
+		ctx->logger->pop_task(EXIT_FAILURE);
+		throw;
+	}
+	ctx->logger->pop_task(EXIT_SUCCESS);
+	
+	// Determine next game state
+	application::state next_state;
+	if (ctx->option_quick_start.has_value())
+	{
+		next_state.name = "play";
+		next_state.enter = std::bind(game::state::play::enter, ctx);
+		next_state.exit = std::bind(game::state::play::exit, ctx);
+	}
+	else
+	{
+		next_state.name = "splash";
+		next_state.enter = std::bind(game::state::splash::enter, ctx);
+		next_state.exit = std::bind(game::state::splash::exit, ctx);
+	}
+	
+	// Queue next game state
+	ctx->app->queue_state(next_state);
+}
+
+void exit(game::context* ctx)
+{}
+
+void cosmogenesis(game::context* ctx)
+{
+	// Init time
+	const double time = 0.0;
+	ctx->astronomy_system->set_universal_time(time);
+	ctx->orbit_system->set_universal_time(time);
+	
+	// Create sun
+	ctx->logger->push_task("Creating the sun");
+	try
+	{
+		heliogenesis(ctx);
+	}
+	catch (...)
+	{
+		ctx->logger->pop_task(EXIT_FAILURE);
+		throw;
+	}
+	ctx->logger->pop_task(EXIT_SUCCESS);
+	
+	// Create planet
+	ctx->logger->push_task("Creating the planet");
+	try
+	{
+		planetogenesis(ctx);
+	}
+	catch (...)
+	{
+		ctx->logger->pop_task(EXIT_FAILURE);
+		throw;
+	}
+	ctx->logger->pop_task(EXIT_SUCCESS);
+	
+	// Create moon
+	ctx->logger->push_task("Creating the moon");
+	try
+	{
+		selenogenesis(ctx);
+	}
+	catch (...)
+	{
+		ctx->logger->pop_task(EXIT_FAILURE);
+		throw;
+	}
+	ctx->logger->pop_task(EXIT_SUCCESS);
+}
+
+void heliogenesis(game::context* ctx)
+{
+	// Create solar entity
+	auto sun_eid = ctx->entity_registry->create();
+	
+	// Name solar entity
+	ctx->named_entities["sun"] = sun_eid;
+	
+	// Assign solar celestial body component
+	entity::component::celestial_body body;
+	body.radius = 6.957e+8;
+	body.axial_tilt = math::radians(0.0);
+	body.axial_rotation = math::radians(0.0);
+	body.angular_frequency = math::radians(0.0);
+	ctx->entity_registry->assign<entity::component::celestial_body>(sun_eid, body);
+	
+	// Assign solar orbit component
+	entity::component::orbit orbit;
+	orbit.elements.a = 0.0;
+	orbit.elements.e = 0.0;
+	orbit.elements.i = math::radians(0.0);
+	orbit.elements.raan = math::radians(0.0);
+	orbit.elements.w = math::radians(0.0);
+	orbit.elements.ta = math::radians(0.0);
+	ctx->entity_registry->assign<entity::component::orbit>(sun_eid, orbit);
+	
+	// Assign solar blackbody component
+	entity::component::blackbody blackbody;
+	blackbody.temperature = 5778.0;
+	ctx->entity_registry->assign<entity::component::blackbody>(sun_eid, blackbody);
+	
+	// Assign solar transform component
+	entity::component::transform transform;
+	transform.local = math::identity_transform<float>;
+	transform.warp = true;
+	ctx->entity_registry->assign<entity::component::transform>(sun_eid, transform);
+	
+	// Create direct sun light scene object
+	scene::directional_light* sun_direct = new scene::directional_light();
+	
+	// Create ambient sun light scene object
+	scene::ambient_light* sun_ambient = new scene::ambient_light();
+	sun_ambient->set_color({1, 1, 1});
+	sun_ambient->set_intensity(0.0f);
+	sun_ambient->update_tweens();
+	
+	// Add sun light scene objects to overworld scene
+	ctx->overworld_scene->add_object(sun_direct);
+	ctx->overworld_scene->add_object(sun_ambient);
+	
+	// Pass direct sun light scene object to shadow map pass and astronomy system
+	ctx->overworld_shadow_map_pass->set_light(sun_direct);
+	ctx->astronomy_system->set_sun_light(sun_direct);
+}
+
+void planetogenesis(game::context* ctx)
+{
+	// Create planetary entity
+	auto planet_eid = ctx->entity_registry->create();
+	
+	// Name planetary entity
+	ctx->named_entities["planet"] = planet_eid;
+	
+	// Assign planetary celestial body component
+	entity::component::celestial_body body;
+	body.radius = 6.3781e6;
+	body.axial_tilt = math::radians(23.4393);
+	body.axial_rotation = math::radians(280.46061837504);
+	body.angular_frequency = math::radians(360.9856122880876128);
+	ctx->entity_registry->assign<entity::component::celestial_body>(planet_eid, body);
+	
+	// Assign planetary orbit component
+	entity::component::orbit orbit;
+	orbit.elements.a = 1.496e+11;
+	orbit.elements.e = 0.01671123;
+	orbit.elements.i = math::radians(-0.00001531);
+	orbit.elements.raan = math::radians(0.0);
+	const double longitude_periapsis = math::radians(102.93768193);
+	orbit.elements.w = longitude_periapsis - orbit.elements.raan;
+	orbit.elements.ta = math::radians(100.46457166) - longitude_periapsis;
+	ctx->entity_registry->assign<entity::component::orbit>(planet_eid, orbit);
+	
+	// Assign planetary terrain component
+	entity::component::terrain terrain;
+	terrain.elevation = [](double, double) -> double
+	{
+		//return math::random<double>(0.0, 1.0);
+		return 0.0;
+	};
+	terrain.max_lod = 18;
+	terrain.patch_material = ctx->resource_manager->load<material>("desert-terrain.mtl");
+	ctx->entity_registry->assign<entity::component::terrain>(planet_eid, terrain);
+	
+	// Assign planetary atmosphere component
+	entity::component::atmosphere atmosphere;
+	atmosphere.exosphere_altitude = 65e3;
+	atmosphere.index_of_refraction = 1.000293;
+	atmosphere.rayleigh_density = 2.545e25;
+	atmosphere.rayleigh_scale_height = 8000.0;
+	atmosphere.mie_density = 14.8875;
+	atmosphere.mie_scale_height = 1200.0;
+	atmosphere.mie_anisotropy = 0.8;
+	ctx->entity_registry->assign<entity::component::atmosphere>(planet_eid, atmosphere);
+	
+	// Assign planetary transform component
+	entity::component::transform transform;
+	transform.local = math::identity_transform<float>;
+	transform.warp = true;
+	ctx->entity_registry->assign<entity::component::transform>(planet_eid, transform);
+	
+	// Pass planet to astronomy system as reference body
+	ctx->astronomy_system->set_reference_body(planet_eid);
+	
+	// Load sky model
+	ctx->overworld_sky_pass->set_sky_model(ctx->resource_manager->load<model>("sky-dome.mdl"));
+}
+
+void selenogenesis(game::context* ctx)
+{
+	// Create lunar entity
+	auto moon_eid = ctx->entity_registry->create();
+	
+	// Name lunar entity
+	ctx->named_entities["moon"] = moon_eid;
+	
+	// Pass moon model to sky pass
+	ctx->overworld_sky_pass->set_moon_model(ctx->resource_manager->load<model>("moon.mdl"));
+}
+
+} // namespace loading
+} // namespace state
+} // namespace game
diff --git a/src/game/states/loading-state.cpp b/src/game/states/loading.hpp
similarity index 58%
rename from src/game/states/loading-state.cpp
rename to src/game/states/loading.hpp
index c26aff1..92ddbd5 100644
--- a/src/game/states/loading-state.cpp
+++ b/src/game/states/loading.hpp
@@ -17,26 +17,23 @@
  * along with Antkeeper source code.  If not, see <http://www.gnu.org/licenses/>.
  */
 
-#include "game/states/game-states.hpp"
-#include "game/game-context.hpp"
-#include "debug/logger.hpp"
-#include "application.hpp"
+#ifndef ANTKEEPER_GAME_STATE_LOADING_HPP
+#define ANTKEEPER_GAME_STATE_LOADING_HPP
 
-void loading_state_enter(game_context* ctx)
-{
-	debug::logger* logger = ctx->logger;
-	logger->push_task("Entering loading state");
+#include "game/context.hpp"
 
-	logger->pop_task(EXIT_SUCCESS);
-	
-	ctx->app->change_state({std::bind(title_state_enter, ctx), std::bind(title_state_exit, ctx)});
-}
+namespace game {
+namespace state {
 
-void loading_state_exit(game_context* ctx)
-{
-	debug::logger* logger = ctx->logger;
-	logger->push_task("Exiting loading state");
+/// Loading game state functions.
+namespace loading {
 
-	logger->pop_task(EXIT_SUCCESS);
-}
+void enter(game::context* ctx);
+void exit(game::context* ctx);
 
+} // namespace loading
+
+} // namespace state
+} // namespace game
+
+#endif // ANTKEEPER_GAME_STATE_LOADING_HPP
diff --git a/src/game/states/map-state.cpp b/src/game/states/nuptial-flight.cpp
similarity index 53%
rename from src/game/states/map-state.cpp
rename to src/game/states/nuptial-flight.cpp
index b0b2727..13c68da 100644
--- a/src/game/states/map-state.cpp
+++ b/src/game/states/nuptial-flight.cpp
@@ -17,38 +17,37 @@
  * along with Antkeeper source code.  If not, see <http://www.gnu.org/licenses/>.
  */
 
-#include "animation/ease.hpp"
+#include "game/states/nuptial-flight.hpp"
+#include "entity/systems/astronomy.hpp"
+#include "entity/systems/orbit.hpp"
+#include "renderer/material-property.hpp"
 #include "animation/screen-transition.hpp"
-#include "animation/timeline.hpp"
-#include "application.hpp"
-#include "debug/logger.hpp"
-#include "game/game-context.hpp"
-#include "input/listener.hpp"
-#include "event/input-events.hpp"
-#include "gl/rasterizer.hpp"
-#include "game/states/game-states.hpp"
-#include "renderer/passes/sky-pass.hpp"
-#include "scene/billboard.hpp"
-#include <functional>
+#include "animation/ease.hpp"
+#include "resources/config-file.hpp"
 
-void map_state_enter(game_context* ctx)
+namespace game {
+namespace state {
+namespace nuptial_flight {
+
+void enter(game::context* ctx)
 {
-	debug::logger* logger = ctx->logger;	
-	logger->push_task("Entering map state");
-	
-	// Disable sky pass
-	ctx->overworld_sky_pass->set_enabled(false);
+	// Pause motion of celestial objects
+	ctx->astronomy_system->set_time_scale(0.0);
+	ctx->orbit_system->set_time_scale(0.0);
 	
-	// Start fade in
+	// Start fade in from white
+	ctx->fade_transition_color->set_value({1, 1, 1});
 	ctx->fade_transition->transition(1.0f, true, ease<float>::in_quad);
-	
-	logger->pop_task(EXIT_SUCCESS);
 }
 
-void map_state_exit(game_context* ctx)
+void exit(game::context* ctx)
 {
-	debug::logger* logger = ctx->logger;
-	logger->push_task("Exiting map state");
-	
-	logger->pop_task(EXIT_SUCCESS);
+	// Resume motion of celestial objects
+	const double time_scale = ctx->config->get<double>("time_scale");
+	ctx->astronomy_system->set_time_scale(time_scale);
+	ctx->orbit_system->set_time_scale(time_scale);
 }
+
+} // namespace nuptial_flight
+} // namespace state
+} // namespace game
diff --git a/src/game/states/game-states.hpp b/src/game/states/nuptial-flight.hpp
similarity index 54%
rename from src/game/states/game-states.hpp
rename to src/game/states/nuptial-flight.hpp
index d7d4530..a03660b 100644
--- a/src/game/states/game-states.hpp
+++ b/src/game/states/nuptial-flight.hpp
@@ -17,22 +17,23 @@
  * along with Antkeeper source code.  If not, see <http://www.gnu.org/licenses/>.
  */
 
-#ifndef ANTKEEPER_GAME_STATES_HPP
-#define ANTKEEPER_GAME_STATES_HPP
-
-struct game_context;
-
-void loading_state_enter(game_context* ctx);
-void loading_state_exit(game_context* ctx);
-void language_select_state_enter(game_context* ctx);
-void language_select_state_exit(game_context* ctx);
-void splash_state_enter(game_context* ctx);
-void splash_state_exit(game_context* ctx);
-void title_state_enter(game_context* ctx);
-void title_state_exit(game_context* ctx);
-void play_state_enter(game_context* ctx);
-void play_state_exit(game_context* ctx);
-void pause_state_enter(game_context* ctx);
-void pause_state_exit(game_context* ctx);
-
-#endif // ANTKEEPER_GAME_STATES_HPP
+#ifndef ANTKEEPER_GAME_STATE_NUPTIAL_FLIGHT_HPP
+#define ANTKEEPER_GAME_STATE_NUPTIAL_FLIGHT_HPP
+
+#include "game/context.hpp"
+
+namespace game {
+namespace state {
+
+/// Nuptial flight game state functions.
+namespace nuptial_flight {
+
+void enter(game::context* ctx);
+void exit(game::context* ctx);
+
+} // namespace nuptial_flight
+
+} // namespace state
+} // namespace game
+
+#endif // ANTKEEPER_GAME_STATE_NUPTIAL_FLIGHT_HPP
diff --git a/src/game/states/play-state.cpp b/src/game/states/play-state.cpp
deleted file mode 100644
index 714b28d..0000000
--- a/src/game/states/play-state.cpp
+++ /dev/null
@@ -1,401 +0,0 @@
-/*
- * Copyright (C) 2021  Christopher J. Howard
- *
- * This file is part of Antkeeper source code.
- *
- * Antkeeper source code is free software: you can redistribute it and/or modify
- * it under the terms of the GNU General Public License as published by
- * the Free Software Foundation, either version 3 of the License, or
- * (at your option) any later version.
- *
- * Antkeeper source code is distributed in the hope that it will be useful,
- * but WITHOUT ANY WARRANTY; without even the implied warranty of
- * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
- * GNU General Public License for more details.
- *
- * You should have received a copy of the GNU General Public License
- * along with Antkeeper source code.  If not, see <http://www.gnu.org/licenses/>.
- */
-
-#include "animation/ease.hpp"
-#include "animation/screen-transition.hpp"
-#include "configuration.hpp"
-#include "debug/logger.hpp"
-#include "entity/archetype.hpp"
-#include "entity/components/cavity.hpp"
-#include "entity/components/copy-transform.hpp"
-#include "entity/components/copy-translation.hpp"
-#include "entity/components/model.hpp"
-#include "entity/components/genome.hpp"
-#include "entity/components/snap.hpp"
-#include "entity/components/terrain.hpp"
-#include "entity/components/tool.hpp"
-#include "entity/components/transform.hpp"
-#include "entity/components/camera-follow.hpp"
-#include "entity/components/orbit.hpp"
-#include "entity/components/blackbody.hpp"
-#include "entity/components/celestial-body.hpp"
-#include "entity/components/atmosphere.hpp"
-#include "entity/components/light.hpp"
-#include "entity/components/observer.hpp"
-#include "entity/commands.hpp"
-#include "game/game-context.hpp"
-#include "game/states/game-states.hpp"
-#include "math/math.hpp"
-#include "nest.hpp"
-#include "renderer/material.hpp"
-#include "gl/texture-2d.hpp"
-#include "gl/texture-filter.hpp"
-#include "gl/texture-wrapping.hpp"
-#include "renderer/model.hpp"
-#include "renderer/passes/sky-pass.hpp"
-#include "renderer/passes/shadow-map-pass.hpp"
-#include "resources/resource-manager.hpp"
-#include "scene/model-instance.hpp"
-#include "scene/collection.hpp"
-#include "scene/camera.hpp"
-#include "scene/ambient-light.hpp"
-#include "scene/directional-light.hpp"
-#include "entity/systems/control.hpp"
-#include "entity/systems/camera.hpp"
-#include "entity/systems/render.hpp"
-#include "entity/systems/tool.hpp"
-#include "entity/systems/orbit.hpp"
-#include "entity/systems/astronomy.hpp"
-#include "game/biome.hpp"
-#include "utility/fundamental-types.hpp"
-#include "utility/bit-math.hpp"
-#include "genetics/genetics.hpp"
-#include "math/random.hpp"
-#include <iostream>
-#include <bitset>
-#include <ctime>
-
-void play_state_enter(game_context* ctx)
-{
-	debug::logger* logger = ctx->logger;
-	logger->push_task("Entering play state");
-	
-	resource_manager* resource_manager = ctx->resource_manager;
-	entt::registry& entity_registry = *ctx->entity_registry;
-	
-	// Load biome
-	if (ctx->option_biome.has_value())
-	{
-		ctx->biome = resource_manager->load<biome>(ctx->option_biome.value() + ".bio");
-	}
-	else
-	{
-		ctx->biome = resource_manager->load<biome>("forest.bio");
-	}
-	
-	// Apply biome parameters to scene
-	sky_pass* sky_pass = ctx->overworld_sky_pass;
-	sky_pass->set_enabled(true);
-	sky_pass->set_sky_model(ctx->resource_manager->load<model>("sky-dome.mdl"));
-	sky_pass->set_moon_model(ctx->resource_manager->load<model>("moon.mdl"));
-	
-	// Create sun
-	auto sun_entity = entity_registry.create();
-	{
-		entity::component::celestial_body body;
-		body.radius = 6.957e+8;
-		body.axial_tilt = math::radians(0.0);
-		body.axial_rotation = math::radians(0.0);
-		body.angular_frequency = math::radians(0.0);
-		
-		entity::component::orbit orbit;
-		orbit.elements.a = 0.0;
-		orbit.elements.e = 0.0;
-		orbit.elements.i = math::radians(0.0);
-		orbit.elements.raan = math::radians(0.0);
-		orbit.elements.w = math::radians(0.0);
-		orbit.elements.ta = math::radians(0.0);
-		
-		entity::component::blackbody blackbody;
-		blackbody.temperature = 5778.0;
-		
-		entity::component::transform transform;
-		transform.local = math::identity_transform<float>;
-		transform.warp = true;
-		
-		entity_registry.assign<entity::component::celestial_body>(sun_entity, body);
-		entity_registry.assign<entity::component::orbit>(sun_entity, orbit);
-		entity_registry.assign<entity::component::blackbody>(sun_entity, blackbody);
-		entity_registry.assign<entity::component::transform>(sun_entity, transform);
-	}
-	
-	// Create Earth
-	auto earth_entity = entity_registry.create();
-	{
-		entity::component::celestial_body body;
-		body.radius = 6.3781e6;
-		body.axial_tilt = math::radians(23.4393);
-		body.axial_rotation = math::radians(280.46061837504);
-		body.angular_frequency = math::radians(360.9856122880876128);
-		
-		entity::component::orbit orbit;
-		orbit.elements.a = 1.496e+11;
-		orbit.elements.e = 0.01671123;
-		orbit.elements.i = math::radians(-0.00001531);
-		orbit.elements.raan = math::radians(0.0);
-		const double longitude_periapsis = math::radians(102.93768193);
-		orbit.elements.w = longitude_periapsis - orbit.elements.raan;
-		orbit.elements.ta = math::radians(100.46457166) - longitude_periapsis;
-		
-		entity::component::terrain terrain;
-		terrain.elevation = [](double, double) -> double
-		{
-			//return math::random<double>(0.0, 1.0);
-			return 0.0;
-		};
-		terrain.max_lod = 18;
-		terrain.patch_material = resource_manager->load<material>("desert-terrain.mtl");
-		
-		entity::component::atmosphere atmosphere;
-		atmosphere.exosphere_altitude = 65e3;
-		atmosphere.index_of_refraction = 1.000293;
-		atmosphere.rayleigh_density = 2.545e25;
-		atmosphere.rayleigh_scale_height = 8000.0;
-		atmosphere.mie_density = 14.8875;
-		atmosphere.mie_scale_height = 1200.0;
-		atmosphere.mie_anisotropy = 0.8;
-		
-		entity::component::transform transform;
-		transform.local = math::identity_transform<float>;
-		transform.warp = true;
-		
-		entity_registry.assign<entity::component::celestial_body>(earth_entity, body);
-		entity_registry.assign<entity::component::orbit>(earth_entity, orbit);
-		entity_registry.assign<entity::component::atmosphere>(earth_entity, atmosphere);
-		entity_registry.assign<entity::component::terrain>(earth_entity, terrain);
-		entity_registry.assign<entity::component::transform>(earth_entity, transform);
-	}
-	
-	// Create observer
-	auto observer_eid = entity_registry.create();
-	{
-		entity::component::observer observer;
-		observer.reference_body_eid = earth_entity;
-		observer.elevation = 0.0;
-		observer.latitude = 0.0;
-		observer.longitude = 0.0;
-		observer.camera = ctx->overworld_camera;
-		
-		entity_registry.assign<entity::component::observer>(observer_eid, observer);
-	}
-	
-	scene::ambient_light* ambient = new scene::ambient_light();
-	ambient->set_color({1, 1, 1});
-	ambient->set_intensity(0.0f);
-	ambient->update_tweens();
-	ctx->overworld_scene->add_object(ambient);
-	
-	scene::directional_light* sun = new scene::directional_light();
-	//sun->set_intensity(1000.0f);
-	//sun->set_light_texture(resource_manager->load<gl::texture_2d>("forest-gobo.tex"));
-	//sun->set_light_texture_scale({2000, 2000});
-	//sun->set_light_texture_opacity(0.925f);
-	//sun->look_at({2, 1, 0}, {0, 0, 0}, {0, 0, 1});
-	//sun->update_tweens();
-	ctx->overworld_scene->add_object(sun);
-	ctx->overworld_shadow_map_pass->set_light(sun);
-	
-	// Set universal time
-	const double universal_time = 0.0;
-	ctx->astronomy_system->set_universal_time(universal_time);
-	ctx->orbit_system->set_universal_time(universal_time);
-	
-	// Set astronomy system observation parameters
-	ctx->astronomy_system->set_reference_body(earth_entity);
-	ctx->astronomy_system->set_observer_location(double3{0.0, math::radians(0.0f), math::radians(0.0f)});
-	ctx->astronomy_system->set_sun_light(sun);
-	ctx->astronomy_system->set_sky_pass(ctx->overworld_sky_pass);
-
-	// Load entity archetypes
-	entity::archetype* ant_hill_archetype = resource_manager->load<entity::archetype>("ant-hill.ent");
-	entity::archetype* nest_archetype = resource_manager->load<entity::archetype>("harvester-nest.ent");
-	entity::archetype* redwood_archetype = resource_manager->load<entity::archetype>("redwood.ent");
-	entity::archetype* forceps_archetype = resource_manager->load<entity::archetype>("forceps.ent");
-	entity::archetype* lens_archetype = resource_manager->load<entity::archetype>("lens.ent");
-	entity::archetype* brush_archetype = resource_manager->load<entity::archetype>("brush.ent");
-	entity::archetype* marker_archetype = resource_manager->load<entity::archetype>("marker.ent");
-	entity::archetype* container_archetype = resource_manager->load<entity::archetype>("container.ent");
-	entity::archetype* twig_archetype = resource_manager->load<entity::archetype>("twig.ent");
-	entity::archetype* larva_archetype = resource_manager->load<entity::archetype>("ant-larva.ent");
-	entity::archetype* flashlight_archetype = resource_manager->load<entity::archetype>("flashlight.ent");
-	entity::archetype* flashlight_light_cone_archetype = resource_manager->load<entity::archetype>("flashlight-light-cone.ent");
-	entity::archetype* lens_light_cone_archetype = resource_manager->load<entity::archetype>("lens-light-cone.ent");
-	entity::archetype* cube_archetype = resource_manager->load<entity::archetype>("unit-cube.ent");
-	entity::archetype* color_checker_archetype = resource_manager->load<entity::archetype>("color-checker.ent");
-	
-	// Create tools
-	/*
-	forceps_archetype->assign(entity_registry, ctx->forceps_entity);
-	lens_archetype->assign(entity_registry, ctx->lens_entity);
-	brush_archetype->assign(entity_registry, ctx->brush_entity);
-	marker_archetype->assign(entity_registry, ctx->marker_entity);
-	container_archetype->assign(entity_registry, ctx->container_entity);
-	twig_archetype->assign(entity_registry, ctx->twig_entity);
-	*/
-	
-	// Create flashlight and light cone, set light cone parent to flashlight, and move both to underworld scene
-	/*
-	flashlight_archetype->assign(entity_registry, ctx->flashlight_entity);
-	auto flashlight_light_cone = flashlight_light_cone_archetype->create(entity_registry);
-	entity::command::parent(entity_registry, flashlight_light_cone, ctx->flashlight_entity);
-	entity::command::assign_render_layers(entity_registry, ctx->flashlight_entity, 2);
-	entity::command::assign_render_layers(entity_registry, flashlight_light_cone, 2);
-	*/
-	
-	// Make lens tool's model instance unculled, so its shadow is always visible.
-	//scene::model_instance* lens_model_instance = ctx->render_system->get_model_instance(ctx->lens_entity);
-	//if (lens_model_instance)
-	//{
-		//lens_model_instance->set_culling_mask(&ctx->no_cull);
-	//}
-	
-	// Create lens light cone and set its parent to lens
-	//auto lens_light_cone = lens_light_cone_archetype->create(entity_registry);
-	//entity::command::bind_transform(entity_registry, lens_light_cone, ctx->lens_entity);
-	//entity::command::parent(entity_registry, lens_light_cone, ctx->lens_entity);
-	
-	// Hide inactive tools
-	/*
-	entity::command::assign_render_layers(entity_registry, ctx->forceps_entity, 0);
-	entity::command::assign_render_layers(entity_registry, ctx->brush_entity, 0);
-	entity::command::assign_render_layers(entity_registry, ctx->lens_entity, 0);
-	entity::command::assign_render_layers(entity_registry, ctx->marker_entity, 0);
-	entity::command::assign_render_layers(entity_registry, ctx->container_entity, 0);
-	entity::command::assign_render_layers(entity_registry, ctx->twig_entity, 0);
-	*/
-	
-	// Activate brush tool
-	//ctx->tool_system->set_active_tool(ctx->brush_entity);
-
-	// Create ant-hill
-	//auto ant_hill_entity = ant_hill_archetype->create(entity_registry);
-	//entity::command::place(entity_registry, ant_hill_entity, earth_entity, 0.0, 0.0, 0.0);
-	
-	// Create color checker
-	/*
-	auto color_checker = color_checker_archetype->create(entity_registry);
-	entity::command::place(entity_registry, color_checker, {-10, -10});
-	auto& cc_transform = entity_registry.get<entity::component::transform>(color_checker);
-	cc_transform.local.scale *= 10.0f;
-	cc_transform.local.rotation = math::angle_axis(math::radians(-90.0f), {1, 0, 0});
-	*/
-	
-	// Setup camera focal point
-	entity::component::transform focal_point_transform;
-	focal_point_transform.local = math::identity_transform<float>;
-	//focal_point_transform.local.translation = {0, 6.3781e6, 0};
-	focal_point_transform.warp = true;
-	entity::component::camera_follow focal_point_follow;
-	entity::component::snap focal_point_snap;
-	focal_point_snap.ray = {float3{0, 10000, 0}, float3{0, -1, 0}};
-	focal_point_snap.warp = false;
-	focal_point_snap.relative = true;
-	focal_point_snap.autoremove = false;
-	entity_registry.assign_or_replace<entity::component::transform>(ctx->focal_point_entity, focal_point_transform);
-	entity_registry.assign_or_replace<entity::component::camera_follow>(ctx->focal_point_entity, focal_point_follow);
-	//entity_registry.assign_or_replace<entity::component::snap>(ctx->focal_point_entity, focal_point_snap);
-	
-	// Setup camera
-	ctx->overworld_camera->look_at({0, 0, 1}, {0, 0, 0}, {0, 1, 0});
-	ctx->overworld_camera->set_exposure(-14.5f);
-	ctx->camera_system->set_camera(ctx->overworld_camera);
-	
-	ctx->overworld_scene->update_tweens();
-	
-	// Allocate a nest
-	nest* nest = new ::nest();
-	
-	// Setup initial nest parameters
-	float tunnel_radius = 1.15f;
-	nest->set_tunnel_radius(tunnel_radius);
-	nest::shaft* central_shaft = nest->get_central_shaft();
-	central_shaft->chirality = 1.0f;
-	central_shaft->rotation = math::radians(0.0f);
-	central_shaft->depth = {0.0f, 200.0f};
-	central_shaft->radius = {15.0f, 15.0f};
-	central_shaft->pitch = {40.0f, 40.0f};
-	central_shaft->translation = {{{0.0f, 0.0f}, {0.0f, 0.0f}}};
-	central_shaft->current_depth = 0.0f;
-	for (std::size_t i = 0; i < 4; ++i)
-	{
-		nest::chamber chamber;
-		chamber.shaft = central_shaft;
-		chamber.depth = (i + 1) * 50.0f;
-		chamber.rotation = math::radians(0.0f);
-		chamber.inner_radius = 4.0f;
-		chamber.outer_radius = 10.0f;
-		central_shaft->chambers.push_back(chamber);
-	}
-	
-	// Dig nest shafts
-	float shift = 0.1f;
-	for (int i = 0; i < 800; ++i)
-	{
-		entity::component::cavity cavity;
-		cavity.position = nest->extend_shaft(*nest->get_central_shaft());
-		cavity.position += float3{math::random(-shift, shift), math::random(-shift, shift), math::random(-shift, shift)};
-		cavity.radius = tunnel_radius * math::random(1.0f, 1.1f);
-
-		entity_registry.assign<entity::component::cavity>(entity_registry.create(), cavity);
-	}
-
-	// Dig nest chambers
-	/*
-	for (int i = 0; i < central_shaft->chambers.size(); ++i)
-	{
-		for (int j = 0; j < 150; ++j)
-		{
-			entity::component::cavity cavity;
-			cavity.position = nest->expand_chamber(central_shaft->chambers[i]);
-			cavity.position += float3{math::random(-shift, shift), math::random(-shift, shift), math::random(-shift, shift)};
-			cavity.radius = tunnel_radius * math::random(1.0f, 1.1f);
-
-			entity_registry.assign<entity::component::cavity>(entity_registry.create(), cavity);
-		}
-	}
-	*/
-	
-	// Place larva in chamber
-	{
-		auto larva_eid = larva_archetype->create(entity_registry);
-		entity::command::assign_render_layers(entity_registry, larva_eid, 1);
-		entity::command::warp_to(entity_registry, larva_eid, {50, 0.1935f, 0});
-		//auto& transform = entity_registry.get<entity::component::transform>(larva_entity);
-		//transform.transform = math::identity_transform<float>;
-		//transform.transform.translation = nest->get_shaft_position(*central_shaft, central_shaft->depth[1]);
-		//transform.transform.translation.y -= 1.0f;
-		
-		// Construct larva genome
-		entity::component::genome genome;
-		genome.ploidy = 2;
-		const std::string antp = "ATGACCATGAGCACCAACAACTGCGAAAGCATGACCAGCTATTTTACCAACAGCTATATGGGCGCGGATATGCATCATGGCCATTATCCGGGCAACGGCGTGACCGATCTGGATGCGCAGCAGATGCATCATTATAGCCAGAACGCGAACCATCAGGGCAACATGCCGTATCCGCGCTTTCCGCCGTATGATCGCATGCCGTATTATAACGGCCAGGGCATGGATCAGCAGCAGCAGCATCAGGTGTATAGCCGCCCGGATAGCCCGAGCAGCCAGGTGGGCGGCGTGATGCCGCAGGCGCAGACCAACGGCCAGCTGGGCGTGCCGCAGCAGCAGCAGCAGCAGCAGCAGCAGCCGAGCCAGAACCAGCAGCAGCAGCAGGCGCAGCAGGCGCCGCAGCAGCTGCAGCAGCAGCTGCCGCAGGTGACCCAGCAGGTGACCCATCCGCAGCAGCAGCAGCAGCAGCCGGTGGTGTATGCGAGCTGCAAACTGCAGGCGGCGGTGGGCGGCCTGGGCATGGTGCCGGAAGGCGGCAGCCCGCCGCTGGTGGATCAGATGAGCGGCCATCATATGAACGCGCAGATGACCCTGCCGCATCATATGGGCCATCCGCAGGCGCAGGTGCATCAGAACCATCATAACATGGGCATGTATCAGCAGCAGAGCGGCGTGCCGCCGGTGGGCGCGCCGCCGCAGGGCATGATGCATCAGGGCCAGGGCCCGCCGCAGATGCATCAGGGCCATCCGGGCCAGCATACCCCGCCGAGCCAGAACCCGAACAGCCAGAGCAGCGGCATGCCGAGCCCGCTGTATCCGTGGATGCGCAGCCAGTTTGAACGCAAACGCGGCCGCCAGACCTATACCCGCTATCAGACCCTGGAACTGGAAAAAGAATTTCATTTTAACCGCTATCTGACCCGCCGCCGCCGCATTGAAATTGCGCATGCGCTGTGCCTGACCGAACGCCAGATTAAAATTTGGTTTCAGAACCGCCGCATGAAATGGAAAAAAGAAAACAAAACCAAAGGCGAACCGGGCAGCGGCGGCGAAGGCGATGAAATTACCCCGCCGAACAGCCCGCAGTAG";
-		genome.chromosomes.push_back(antp);
-		entity_registry.assign<entity::component::genome>(larva_eid, genome);
-	}
-	
-	entity::system::control* control_system = ctx->control_system;
-	control_system->update(0.0, 0.0);
-	control_system->set_nest(nest);
-	
-	// Start fade in
-	ctx->fade_transition->transition(1.0f, true, ease<float>::in_quad);
-
-	logger->pop_task(EXIT_SUCCESS);
-	
-	std::string biome_name = (*ctx->strings)[ctx->biome->name];
-	logger->log("Entered biome \"" + biome_name + "\"");
-}
-
-void play_state_exit(game_context* ctx)
-{
-	debug::logger* logger = ctx->logger;
-	logger->push_task("Exiting play state");
-	
-	logger->pop_task(EXIT_SUCCESS);
-}
diff --git a/src/game/states/play.cpp b/src/game/states/play.cpp
new file mode 100644
index 0000000..e1bce7b
--- /dev/null
+++ b/src/game/states/play.cpp
@@ -0,0 +1,100 @@
+/*
+ * Copyright (C) 2021  Christopher J. Howard
+ *
+ * This file is part of Antkeeper source code.
+ *
+ * Antkeeper source code is free software: you can redistribute it and/or modify
+ * it under the terms of the GNU General Public License as published by
+ * the Free Software Foundation, either version 3 of the License, or
+ * (at your option) any later version.
+ *
+ * Antkeeper source code is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Antkeeper source code.  If not, see <http://www.gnu.org/licenses/>.
+ */
+
+#include "game/states/play.hpp"
+#include "entity/archetype.hpp"
+#include "entity/commands.hpp"
+#include "entity/components/observer.hpp"
+#include "entity/components/camera-follow.hpp"
+#include "entity/components/transform.hpp"
+#include "entity/systems/astronomy.hpp"
+#include "entity/systems/control.hpp"
+#include "entity/systems/camera.hpp"
+#include "animation/screen-transition.hpp"
+#include "animation/ease.hpp"
+#include "resources/resource-manager.hpp"
+
+namespace game {
+namespace state {
+namespace play {
+
+void enter(game::context* ctx)
+{
+	// Find planet EID by name
+	entity::id planet_eid = entt::null;
+	if (auto it = ctx->named_entities.find("planet"); it != ctx->named_entities.end())
+	{
+		planet_eid = it->second;
+	}
+	
+	// Create observer
+	auto observer_eid = ctx->entity_registry->create();
+	{
+		entity::component::observer observer;
+		observer.reference_body_eid = planet_eid;
+		observer.elevation = 0.0;
+		observer.latitude = 0.0;
+		observer.longitude = 0.0;
+		observer.camera = ctx->overworld_camera;
+		ctx->entity_registry->assign<entity::component::observer>(observer_eid, observer);
+		
+		// Set reference location of astronomy system
+		ctx->astronomy_system->set_reference_body(planet_eid);
+		ctx->astronomy_system->set_observer_location(double3{0.0, math::radians(0.0), math::radians(0.0)});
+	}
+	
+	// Create camera focal point
+	{
+		entity::component::transform focal_point_transform;
+		focal_point_transform.local = math::identity_transform<float>;
+		focal_point_transform.warp = true;
+		ctx->entity_registry->assign_or_replace<entity::component::transform>(ctx->focal_point_entity, focal_point_transform);
+		
+		entity::component::camera_follow focal_point_follow;
+		ctx->entity_registry->assign_or_replace<entity::component::camera_follow>(ctx->focal_point_entity, focal_point_follow);
+	}
+	
+	// Setup camera
+	ctx->overworld_camera->look_at({0, 0, 1}, {0, 0, 0}, {0, 1, 0});
+	ctx->overworld_camera->set_exposure(-14.5f);
+	ctx->camera_system->set_camera(ctx->overworld_camera);
+	
+	entity::system::control* control_system = ctx->control_system;
+	control_system->update(0.0, 0.0);
+	control_system->set_nest(nullptr);
+	
+	// Create larva
+	{
+		entity::archetype* larva_archetype = ctx->resource_manager->load<entity::archetype>("ant-larva.ent");
+		auto larva_eid = larva_archetype->create(*ctx->entity_registry);
+		entity::command::warp_to(*ctx->entity_registry, larva_eid, {50, 0.1935f, 0});
+	}
+	
+	ctx->overworld_scene->update_tweens();
+	
+	// Start fade in
+	ctx->fade_transition->transition(1.0f, true, ease<float>::in_quad);
+}
+
+void exit(game::context* ctx)
+{}
+
+} // namespace play
+} // namespace state
+} // namespace game
diff --git a/src/game/states/language-select-state.cpp b/src/game/states/play.hpp
similarity index 68%
rename from src/game/states/language-select-state.cpp
rename to src/game/states/play.hpp
index 1205e4f..0ab8ac2 100644
--- a/src/game/states/language-select-state.cpp
+++ b/src/game/states/play.hpp
@@ -17,14 +17,23 @@
  * along with Antkeeper source code.  If not, see <http://www.gnu.org/licenses/>.
  */
 
-#include "game/states/game-states.hpp"
-#include "game/game-context.hpp"
+#ifndef ANTKEEPER_GAME_STATE_PLAY_HPP
+#define ANTKEEPER_GAME_STATE_PLAY_HPP
 
-void language_select_state_enter(game_context* ctx)
-{
-}
+#include "game/context.hpp"
 
-void language_select_state_exit(game_context* ctx)
-{
-}
+namespace game {
+namespace state {
 
+/// Play game state functions.
+namespace play {
+
+void enter(game::context* ctx);
+void exit(game::context* ctx);
+
+} // namespace play
+
+} // namespace state
+} // namespace game
+
+#endif // ANTKEEPER_GAME_STATE_PLAY_HPP
diff --git a/src/game/states/splash-state.cpp b/src/game/states/splash.cpp
similarity index 74%
rename from src/game/states/splash-state.cpp
rename to src/game/states/splash.cpp
index f82e1e4..48907a6 100644
--- a/src/game/states/splash-state.cpp
+++ b/src/game/states/splash.cpp
@@ -17,31 +17,19 @@
  * along with Antkeeper source code.  If not, see <http://www.gnu.org/licenses/>.
  */
 
-#include "animation/ease.hpp"
+#include "game/states/splash.hpp"
+#include "game/states/play.hpp"
 #include "animation/screen-transition.hpp"
+#include "animation/ease.hpp"
 #include "animation/timeline.hpp"
 #include "application.hpp"
-#include "debug/logger.hpp"
-#include "game/game-context.hpp"
-#include "input/listener.hpp"
-#include "event/input-events.hpp"
-#include "gl/rasterizer.hpp"
-#include "game/states/game-states.hpp"
-#include "renderer/passes/sky-pass.hpp"
-#include "scene/billboard.hpp"
-#include "scene/collection.hpp"
-#include <functional>
 
-void splash_state_enter(game_context* ctx)
+namespace game {
+namespace state {
+namespace splash {
+
+void enter(game::context* ctx)
 {
-	debug::logger* logger = ctx->logger;	
-	logger->push_task("Entering splash state");
-	
-	//ctx->app->set_window_opacity(0.5f);
-	
-	// Disable sky pass
-	ctx->overworld_sky_pass->set_enabled(false);
-	
 	// Add splash billboard to UI scene
 	ctx->ui_scene->add_object(ctx->splash_billboard);
 	
@@ -62,7 +50,12 @@ void splash_state_enter(game_context* ctx)
 	// Create change state function
 	auto change_state = [ctx]()
 	{
-		ctx->app->change_state({std::bind(play_state_enter, ctx), std::bind(play_state_exit, ctx)});
+		application::state next_state;
+		next_state.name = "play";
+		next_state.enter = std::bind(game::state::play::enter, ctx);
+		next_state.exit = std::bind(game::state::play::exit, ctx);
+		
+		ctx->app->change_state(next_state);
 	};
 	
 	// Schedule fade out and change state events
@@ -88,26 +81,29 @@ void splash_state_enter(game_context* ctx)
 				ctx->rasterizer->set_clear_color(0.0f, 0.0f, 0.0f, 1.0f);
 				ctx->rasterizer->clear_framebuffer(true, false, false);
 				ctx->app->swap_buffers();
-				ctx->app->change_state({std::bind(play_state_enter, ctx), std::bind(play_state_exit, ctx)});
+				
+				application::state next_state;
+				next_state.name = "play";
+				next_state.enter = std::bind(game::state::play::enter, ctx);
+				next_state.exit = std::bind(game::state::play::exit, ctx);
+				
+				ctx->app->change_state(next_state);
 			}
 		}
 	);
 	ctx->input_listener->set_enabled(true);
-	
-	logger->pop_task(EXIT_SUCCESS);
 }
 
-void splash_state_exit(game_context* ctx)
+void exit(game::context* ctx)
 {
-	debug::logger* logger = ctx->logger;
-	logger->push_task("Exiting splash state");
-	
 	// Disable splash skipper
 	ctx->input_listener->set_enabled(false);
 	ctx->input_listener->set_callback(nullptr);
 	
 	// Remove splash billboard from UI scene
 	ctx->ui_scene->remove_object(ctx->splash_billboard);
-	
-	logger->pop_task(EXIT_SUCCESS);
 }
+
+} // namespace splash
+} // namespace state
+} // namespace game
diff --git a/src/game/states/splash.hpp b/src/game/states/splash.hpp
new file mode 100644
index 0000000..bfb8999
--- /dev/null
+++ b/src/game/states/splash.hpp
@@ -0,0 +1,39 @@
+/*
+ * Copyright (C) 2021  Christopher J. Howard
+ *
+ * This file is part of Antkeeper source code.
+ *
+ * Antkeeper source code is free software: you can redistribute it and/or modify
+ * it under the terms of the GNU General Public License as published by
+ * the Free Software Foundation, either version 3 of the License, or
+ * (at your option) any later version.
+ *
+ * Antkeeper source code is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with Antkeeper source code.  If not, see <http://www.gnu.org/licenses/>.
+ */
+
+#ifndef ANTKEEPER_GAME_STATE_SPLASH_HPP
+#define ANTKEEPER_GAME_STATE_SPLASH_HPP
+
+#include "game/context.hpp"
+
+namespace game {
+namespace state {
+
+/// Splash screen game state functions.
+namespace splash {
+
+void enter(game::context* ctx);
+void exit(game::context* ctx);
+
+} // namespace splash
+
+} // namespace state
+} // namespace game
+
+#endif // ANTKEEPER_GAME_STATE_SPLASH_HPP
diff --git a/src/game/states/pause-state.cpp b/src/game/states/states.hpp
similarity index 75%
rename from src/game/states/pause-state.cpp
rename to src/game/states/states.hpp
index 0e134fa..cdbd1ce 100644
--- a/src/game/states/pause-state.cpp
+++ b/src/game/states/states.hpp
@@ -17,14 +17,17 @@
  * along with Antkeeper source code.  If not, see <http://www.gnu.org/licenses/>.
  */
 
-#include "game/states/game-states.hpp"
-#include "game/game-context.hpp"
+#ifndef ANTKEEPER_GAME_STATES_HPP
+#define ANTKEEPER_GAME_STATES_HPP
 
-void pause_state_enter(game_context* ctx)
-{
-}
+namespace game {
 
-void pause_state_exit(game_context* ctx)
-{
-}
+/// Game state functions.
+namespace state {}
 
+} // namespace game
+
+#include "game/states/loading.hpp"
+#include "game/states/splash.hpp"
+
+#endif // ANTKEEPER_GAME_STATES_HPP
diff --git a/src/game/states/title-state.cpp b/src/game/states/title-state.cpp
deleted file mode 100644
index 7561df7..0000000
--- a/src/game/states/title-state.cpp
+++ /dev/null
@@ -1,55 +0,0 @@
-/*
- * Copyright (C) 2021  Christopher J. Howard
- *
- * This file is part of Antkeeper source code.
- *
- * Antkeeper source code is free software: you can redistribute it and/or modify
- * it under the terms of the GNU General Public License as published by
- * the Free Software Foundation, either version 3 of the License, or
- * (at your option) any later version.
- *
- * Antkeeper source code is distributed in the hope that it will be useful,
- * but WITHOUT ANY WARRANTY; without even the implied warranty of
- * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
- * GNU General Public License for more details.
- *
- * You should have received a copy of the GNU General Public License
- * along with Antkeeper source code.  If not, see <http://www.gnu.org/licenses/>.
- */
-
-#include "game/states/game-states.hpp"
-#include "game/game-context.hpp"
-#include "debug/logger.hpp"
-#include "animation/timeline.hpp"
-
-void title_state_enter(game_context* ctx)
-{
-	debug::logger* logger = ctx->logger;
-	logger->push_task("Entering title state");
-
-	// Get timeline
-	timeline* timeline = ctx->timeline;
-	
-	// Create title sequence
-	float t = timeline->get_position();
-	timeline::sequence title_sequence =
-	{
-		{t +  0.0f, [logger](){ logger->log("cue sound fade-in\n"); }},
-		{t +  3.0f, [logger](){ logger->log("cue scene fade-in from black\n"); }},
-		{t +  8.0f, [logger](){ logger->log("cue title fade-in\n"); }},
-		{t + 10.0f, [logger](){ logger->log("cue menu fade-in\n"); }}
-	};
-
-	// Add title sequence to timeline
-	timeline->add_sequence(title_sequence);
-
-	logger->pop_task(EXIT_SUCCESS);
-}
-
-void title_state_exit(game_context* ctx)
-{
-	debug::logger* logger = ctx->logger;
-	logger->push_task("Exiting title state");
-
-	logger->pop_task(EXIT_SUCCESS);
-}