|
|
- /*
- * Copyright (C) 2021 Christopher J. Howard
- *
- * This file is part of Antkeeper source code.
- *
- * Antkeeper source code is free software: you can redistribute it and/or modify
- * it under the terms of the GNU General Public License as published by
- * the Free Software Foundation, either version 3 of the License, or
- * (at your option) any later version.
- *
- * Antkeeper source code is distributed in the hope that it will be useful,
- * but WITHOUT ANY WARRANTY; without even the implied warranty of
- * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
- * GNU General Public License for more details.
- *
- * You should have received a copy of the GNU General Public License
- * along with Antkeeper source code. If not, see <http://www.gnu.org/licenses/>.
- */
-
- #include "animation/ease.hpp"
- #include "animation/screen-transition.hpp"
- #include "configuration.hpp"
- #include "debug/logger.hpp"
- #include "ecs/archetype.hpp"
- #include "ecs/components/cavity-component.hpp"
- #include "ecs/components/copy-transform-component.hpp"
- #include "ecs/components/copy-translation-component.hpp"
- #include "ecs/components/model-component.hpp"
- #include "ecs/components/snap-component.hpp"
- #include "ecs/components/terrain-component.hpp"
- #include "ecs/components/tool-component.hpp"
- #include "ecs/components/transform-component.hpp"
- #include "ecs/components/camera-follow-component.hpp"
- #include "ecs/components/orbit-component.hpp"
- #include "ecs/components/blackbody-component.hpp"
- #include "ecs/components/atmosphere-component.hpp"
- #include "ecs/components/light-component.hpp"
- #include "ecs/commands.hpp"
- #include "game/game-context.hpp"
- #include "game/states/game-states.hpp"
- #include "math/math.hpp"
- #include "nest.hpp"
- #include "renderer/material.hpp"
- #include "gl/texture-2d.hpp"
- #include "gl/texture-filter.hpp"
- #include "gl/texture-wrapping.hpp"
- #include "renderer/model.hpp"
- #include "renderer/passes/sky-pass.hpp"
- #include "renderer/passes/shadow-map-pass.hpp"
- #include "resources/resource-manager.hpp"
- #include "scene/model-instance.hpp"
- #include "scene/collection.hpp"
- #include "scene/camera.hpp"
- #include "scene/ambient-light.hpp"
- #include "scene/directional-light.hpp"
- #include "ecs/systems/control-system.hpp"
- #include "ecs/systems/camera-system.hpp"
- #include "ecs/systems/render-system.hpp"
- #include "ecs/systems/tool-system.hpp"
- #include "ecs/systems/orbit-system.hpp"
- #include "ecs/systems/astronomy-system.hpp"
- #include "game/biome.hpp"
- #include "utility/fundamental-types.hpp"
-
- #include "utility/bit-math.hpp"
- #include "genetics/genetics.hpp"
- #include <iostream>
- #include <bitset>
- #include <ctime>
-
-
- void play_state_enter(game_context* ctx)
- {
- debug::logger* logger = ctx->logger;
- logger->push_task("Entering play state");
-
- resource_manager* resource_manager = ctx->resource_manager;
- entt::registry& ecs_registry = *ctx->ecs_registry;
-
- // Load biome
- if (ctx->option_biome.has_value())
- {
- ctx->biome = resource_manager->load<biome>(ctx->option_biome.value() + ".bio");
- }
- else
- {
- ctx->biome = resource_manager->load<biome>("forest.bio");
- }
-
- // Apply biome parameters to scene
- sky_pass* sky_pass = ctx->overworld_sky_pass;
- sky_pass->set_enabled(true);
- sky_pass->set_sky_model(ctx->resource_manager->load<model>("sky-dome.mdl"));
- sky_pass->set_moon_model(ctx->resource_manager->load<model>("moon.mdl"));
-
- // Create sun
- auto sun_entity = ecs_registry.create();
- {
- ecs::orbit_component orbit;
- orbit.elements.a = 0.0;
- orbit.elements.e = 0.0;
- orbit.elements.i = math::radians(0.0);
- orbit.elements.raan = math::radians(0.0);
- orbit.elements.w = math::radians(0.0);
- orbit.elements.ta = math::radians(0.0);
-
- ecs::blackbody_component blackbody;
- blackbody.temperature = 5777.0;
- blackbody.radius = 6.957e+8;
-
- ecs::transform_component transform;
- transform.local = math::identity_transform<float>;
- transform.warp = true;
-
- ecs_registry.assign<ecs::orbit_component>(sun_entity, orbit);
- ecs_registry.assign<ecs::blackbody_component>(sun_entity, blackbody);
- ecs_registry.assign<ecs::transform_component>(sun_entity, transform);
- }
-
- // Create Earth
- auto earth_entity = ecs_registry.create();
- {
- ecs::orbit_component orbit;
- orbit.elements.a = 1.496e+11;
- orbit.elements.e = 0.01671123;
- orbit.elements.i = math::radians(-0.00001531);
- orbit.elements.raan = math::radians(0.0);
- const double longitude_periapsis = math::radians(102.93768193);
- orbit.elements.w = longitude_periapsis - orbit.elements.raan;
- orbit.elements.ta = math::radians(100.46457166) - longitude_periapsis;
-
- ecs::atmosphere_component atmosphere;
- atmosphere.exosphere_altitude = 100e3;
-
- atmosphere.index_of_refraction = 1.0003;
- atmosphere.rayleigh_density = 2.545e25;
- atmosphere.mie_density = 14.8875;
-
- atmosphere.rayleigh_scale_height = 8000.0;
- atmosphere.mie_scale_height = 1200.0;
- atmosphere.mie_asymmetry = 0.8;
-
- ecs::transform_component transform;
- transform.local = math::identity_transform<float>;
- transform.warp = true;
-
- ecs_registry.assign<ecs::orbit_component>(earth_entity, orbit);
- ecs_registry.assign<ecs::atmosphere_component>(earth_entity, atmosphere);
- ecs_registry.assign<ecs::transform_component>(earth_entity, transform);
- }
-
- scene::ambient_light* ambient = new scene::ambient_light();
- ambient->set_color({1, 1, 1});
- ambient->set_intensity(0.0f);
- ambient->update_tweens();
- ctx->overworld_scene->add_object(ambient);
-
- scene::directional_light* sun = new scene::directional_light();
- //sun->set_intensity(1000.0f);
- //sun->set_light_texture(resource_manager->load<gl::texture_2d>("forest-gobo.tex"));
- //sun->set_light_texture_scale({2000, 2000});
- //sun->set_light_texture_opacity(0.925f);
- //sun->look_at({2, 1, 0}, {0, 0, 0}, {0, 0, 1});
- //sun->update_tweens();
- ctx->overworld_scene->add_object(sun);
- ctx->overworld_shadow_map_pass->set_light(sun);
-
- // Set universal time
- const double universal_time = 0.0;
- ctx->astronomy_system->set_universal_time(universal_time);
- ctx->orbit_system->set_universal_time(universal_time);
-
- // Set astronomy system observation parameters
- ctx->astronomy_system->set_reference_body(earth_entity);
- ctx->astronomy_system->set_reference_body_axial_tilt(math::radians(23.4393));
- ctx->astronomy_system->set_observer_location(double3{6.3781e6, math::radians(0.0f), math::radians(0.0f)});
- ctx->astronomy_system->set_sun_light(sun);
- ctx->astronomy_system->set_sky_pass(ctx->overworld_sky_pass);
-
- // Load entity archetypes
- ecs::archetype* ant_hill_archetype = resource_manager->load<ecs::archetype>("ant-hill.ent");
- ecs::archetype* nest_archetype = resource_manager->load<ecs::archetype>("harvester-nest.ent");
- ecs::archetype* redwood_archetype = resource_manager->load<ecs::archetype>("redwood.ent");
- ecs::archetype* forceps_archetype = resource_manager->load<ecs::archetype>("forceps.ent");
- ecs::archetype* lens_archetype = resource_manager->load<ecs::archetype>("lens.ent");
- ecs::archetype* brush_archetype = resource_manager->load<ecs::archetype>("brush.ent");
- ecs::archetype* marker_archetype = resource_manager->load<ecs::archetype>("marker.ent");
- ecs::archetype* container_archetype = resource_manager->load<ecs::archetype>("container.ent");
- ecs::archetype* twig_archetype = resource_manager->load<ecs::archetype>("twig.ent");
- ecs::archetype* larva_archetype = resource_manager->load<ecs::archetype>("ant-larva.ent");
- ecs::archetype* flashlight_archetype = resource_manager->load<ecs::archetype>("flashlight.ent");
- ecs::archetype* flashlight_light_cone_archetype = resource_manager->load<ecs::archetype>("flashlight-light-cone.ent");
- ecs::archetype* lens_light_cone_archetype = resource_manager->load<ecs::archetype>("lens-light-cone.ent");
- ecs::archetype* cube_archetype = resource_manager->load<ecs::archetype>("unit-cube.ent");
- ecs::archetype* color_checker_archetype = resource_manager->load<ecs::archetype>("color-checker.ent");
-
- // Create tools
- forceps_archetype->assign(ecs_registry, ctx->forceps_entity);
- lens_archetype->assign(ecs_registry, ctx->lens_entity);
- brush_archetype->assign(ecs_registry, ctx->brush_entity);
- marker_archetype->assign(ecs_registry, ctx->marker_entity);
- container_archetype->assign(ecs_registry, ctx->container_entity);
- twig_archetype->assign(ecs_registry, ctx->twig_entity);
-
- // Create flashlight and light cone, set light cone parent to flashlight, and move both to underworld scene
- flashlight_archetype->assign(ecs_registry, ctx->flashlight_entity);
- auto flashlight_light_cone = flashlight_light_cone_archetype->create(ecs_registry);
- ecs::command::parent(ecs_registry, flashlight_light_cone, ctx->flashlight_entity);
- ecs::command::assign_render_layers(ecs_registry, ctx->flashlight_entity, 2);
- ecs::command::assign_render_layers(ecs_registry, flashlight_light_cone, 2);
-
- // Make lens tool's model instance unculled, so its shadow is always visible.
- scene::model_instance* lens_model_instance = ctx->render_system->get_model_instance(ctx->lens_entity);
- if (lens_model_instance)
- {
- //lens_model_instance->set_culling_mask(&ctx->no_cull);
- }
-
- // Create lens light cone and set its parent to lens
- auto lens_light_cone = lens_light_cone_archetype->create(ecs_registry);
- ecs::command::bind_transform(ecs_registry, lens_light_cone, ctx->lens_entity);
- ecs::command::parent(ecs_registry, lens_light_cone, ctx->lens_entity);
-
- // Hide inactive tools
- ecs::command::assign_render_layers(ecs_registry, ctx->forceps_entity, 0);
- ecs::command::assign_render_layers(ecs_registry, ctx->brush_entity, 0);
- ecs::command::assign_render_layers(ecs_registry, ctx->lens_entity, 0);
- ecs::command::assign_render_layers(ecs_registry, ctx->marker_entity, 0);
- ecs::command::assign_render_layers(ecs_registry, ctx->container_entity, 0);
- ecs::command::assign_render_layers(ecs_registry, ctx->twig_entity, 0);
-
- // Activate brush tool
- ctx->tool_system->set_active_tool(ctx->brush_entity);
-
- // Create ant-hill
- auto ant_hill_entity = ant_hill_archetype->create(ecs_registry);
- ecs::command::place(ecs_registry, ant_hill_entity, {0, -40});
-
- // Creat nest
- auto nest_entity = nest_archetype->create(ecs_registry);
-
- // Create terrain
- int terrain_radius = 0;//6;
- for (int x = -terrain_radius; x <= terrain_radius; ++x)
- {
- for (int z = -terrain_radius; z <= terrain_radius; ++z)
- {
- ecs::terrain_component terrain_component;
- terrain_component.subdivisions = TERRAIN_PATCH_RESOLUTION;
- terrain_component.x = x;
- terrain_component.z = z;
- auto terrain_entity = ecs_registry.create();
- ecs_registry.assign<ecs::terrain_component>(terrain_entity, terrain_component);
- }
- }
-
- // Create trees
- for (int i = 0; i < 0; ++i)
- {
- auto redwood = redwood_archetype->create(ecs_registry);
-
- auto& transform = ecs_registry.get<ecs::transform_component>(redwood);
- float zone = 500.0f;
- ecs::command::place(ecs_registry, redwood, {math::random(-zone, zone), math::random(-zone, zone)});
- }
-
- // Create unit cube
- auto cube = cube_archetype->create(ecs_registry);
- ecs::command::place(ecs_registry, cube, {10, 10});
-
- // Create color checker
- auto color_checker = color_checker_archetype->create(ecs_registry);
- ecs::command::place(ecs_registry, color_checker, {-10, -10});
- auto& cc_transform = ecs_registry.get<ecs::transform_component>(color_checker);
- cc_transform.local.scale *= 10.0f;
- cc_transform.local.rotation = math::angle_axis(math::radians(-90.0f), {1, 0, 0});
-
- // Setup camera focal point
- ecs::transform_component focal_point_transform;
- focal_point_transform.local = math::identity_transform<float>;
- focal_point_transform.warp = true;
- ecs::camera_follow_component focal_point_follow;
- ecs::snap_component focal_point_snap;
- focal_point_snap.ray = {float3{0, 10000, 0}, float3{0, -1, 0}};
- focal_point_snap.warp = false;
- focal_point_snap.relative = true;
- focal_point_snap.autoremove = false;
- ecs_registry.assign_or_replace<ecs::transform_component>(ctx->focal_point_entity, focal_point_transform);
- ecs_registry.assign_or_replace<ecs::camera_follow_component>(ctx->focal_point_entity, focal_point_follow);
- ecs_registry.assign_or_replace<ecs::snap_component>(ctx->focal_point_entity, focal_point_snap);
-
- // Setup camera
- ctx->overworld_camera->look_at({0, 0, 1}, {0, 0, 0}, {0, 1, 0});
- ctx->camera_system->set_camera(ctx->overworld_camera);
-
- ctx->overworld_scene->update_tweens();
-
- // Allocate a nest
- nest* nest = new ::nest();
-
- // Setup initial nest parameters
- float tunnel_radius = 1.15f;
- nest->set_tunnel_radius(tunnel_radius);
- nest::shaft* central_shaft = nest->get_central_shaft();
- central_shaft->chirality = 1.0f;
- central_shaft->rotation = math::radians(0.0f);
- central_shaft->depth = {0.0f, 200.0f};
- central_shaft->radius = {15.0f, 15.0f};
- central_shaft->pitch = {40.0f, 40.0f};
- central_shaft->translation = {{{0.0f, 0.0f}, {0.0f, 0.0f}}};
- central_shaft->current_depth = 0.0f;
- for (std::size_t i = 0; i < 4; ++i)
- {
- nest::chamber chamber;
- chamber.shaft = central_shaft;
- chamber.depth = (i + 1) * 50.0f;
- chamber.rotation = math::radians(0.0f);
- chamber.inner_radius = 4.0f;
- chamber.outer_radius = 10.0f;
- central_shaft->chambers.push_back(chamber);
- }
-
- // Dig nest shafts
- float shift = 0.1f;
- for (int i = 0; i < 800; ++i)
- {
- ecs::cavity_component cavity;
- cavity.position = nest->extend_shaft(*nest->get_central_shaft());
- cavity.position += float3{math::random(-shift, shift), math::random(-shift, shift), math::random(-shift, shift)};
- cavity.radius = tunnel_radius * math::random(1.0f, 1.1f);
-
- ecs_registry.assign<ecs::cavity_component>(ecs_registry.create(), cavity);
- }
-
- // Dig nest chambers
- /*
- for (int i = 0; i < central_shaft->chambers.size(); ++i)
- {
- for (int j = 0; j < 150; ++j)
- {
- ecs::cavity_component cavity;
- cavity.position = nest->expand_chamber(central_shaft->chambers[i]);
- cavity.position += float3{math::random(-shift, shift), math::random(-shift, shift), math::random(-shift, shift)};
- cavity.radius = tunnel_radius * math::random(1.0f, 1.1f);
-
- ecs_registry.assign<ecs::cavity_component>(ecs_registry.create(), cavity);
- }
- }
- */
-
- // Place larva in chamber
- {
- auto larva = larva_archetype->create(ecs_registry);
- ecs::command::assign_render_layers(ecs_registry, larva, 1);
- ecs::command::warp_to(ecs_registry, larva, {50, 0.1935f, 0});
- //auto& transform = ecs_registry.get<ecs::transform_component>(larva_entity);
- //transform.transform = math::identity_transform<float>;
- //transform.transform.translation = nest->get_shaft_position(*central_shaft, central_shaft->depth[1]);
- //transform.transform.translation.y -= 1.0f;
- }
-
- ecs::control_system* control_system = ctx->control_system;
- control_system->update(0.0, 0.0);
- control_system->set_nest(nest);
-
- // Start fade in
- ctx->fade_transition->transition(1.0f, true, ease<float>::in_quad);
-
- logger->pop_task(EXIT_SUCCESS);
-
- std::string biome_name = (*ctx->strings)[ctx->biome->name];
- logger->log("Entered biome \"" + biome_name + "\"");
-
-
- std::srand(std::time(nullptr));
- //auto rng = [](){ return std::rand(); };
-
- std::random_device rd;
- std::mt19937 rng(rd());
-
-
- std::string sequence_a = "CCTTGCCCTTTGGGTCGCCCCCCTAG";
- std::string sequence_b = "ATGTTTCCCGAAGGGTAG";
- std::string sequence_c = "AAATGCCCCCCCCCCCCCCCCCCCCCCCCCCCTAGAAAAAAAAA";
- std::string orf_a;
- std::string protein_a;
- std::string protein_b;
- std::string protein_c;
-
-
- std::cout << "sequence a: " << sequence_a << std::endl;
- genetics::sequence::transcribe(sequence_a.begin(), sequence_a.end(), sequence_a.begin());
- std::cout << "sequence a: " << sequence_a << std::endl;
-
- std::string complement;
- genetics::sequence::rna::complement(sequence_a.begin(), sequence_a.end(), std::back_inserter(complement));
- std::cout << "complement: " << complement << std::endl;
-
- auto orf = genetics::sequence::find_orf(sequence_a.begin(), sequence_a.end(), genetics::standard_code);
- if (orf.start != sequence_a.end())
- {
- std::copy(orf.start, orf.stop, std::back_inserter(orf_a));
- std::cout << "orf a: " << orf_a << std::endl;
-
- genetics::sequence::translate(orf.start, orf.stop, std::back_inserter(protein_a), genetics::standard_code);
- std::cout << "protein a: " << protein_a << std::endl;
- }
-
- protein_b = "MFFFFP";
- protein_c = "MFFFYP";
- int score;
-
- std::cout << std::endl;
- std::cout << "protein_b: " << protein_b << std::endl;
- std::cout << "protein_c: " << protein_c << std::endl;
-
- score = genetics::protein::score(protein_b.begin(), protein_b.end(), protein_c.begin(), genetics::matrix::blosum62<int>);
- std::cout << "score blosum62: " << score << std::endl;
-
- score = genetics::protein::score(protein_b.begin(), protein_b.end(), protein_c.begin(), genetics::matrix::blosum80<int>);
- std::cout << "score blosum80: " << score << std::endl;
-
-
- std::cout << "identity : " << genetics::protein::identity<float>(protein_b.begin(), protein_b.end(), protein_c.begin()) << std::endl;
- std::cout << "similarity62: " << genetics::protein::similarity<float>(protein_b.begin(), protein_b.end(), protein_c.begin(), genetics::matrix::blosum62<int>) << std::endl;
- std::cout << "similarity80: " << genetics::protein::similarity<float>(protein_b.begin(), protein_b.end(), protein_c.begin(), genetics::matrix::blosum80<int>) << std::endl;
-
-
- }
-
- void play_state_exit(game_context* ctx)
- {
- debug::logger* logger = ctx->logger;
- logger->push_task("Exiting play state");
-
- logger->pop_task(EXIT_SUCCESS);
- }
|